ID: 1011859469

View in Genome Browser
Species Human (GRCh38)
Location 6:91737206-91737228
Sequence GACTCCATGGAGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011859467_1011859469 1 Left 1011859467 6:91737182-91737204 CCAAATTTGTATTTCAAAGTCTT No data
Right 1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG No data
1011859466_1011859469 21 Left 1011859466 6:91737162-91737184 CCTTATAATGGCTTGGAAGGCCA No data
Right 1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011859469 Original CRISPR GACTCCATGGAGTTTCTCAC TGG Intergenic
No off target data available for this crispr