ID: 1011870971

View in Genome Browser
Species Human (GRCh38)
Location 6:91892221-91892243
Sequence ATGTTTAAGGGGATTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011870971_1011870978 -1 Left 1011870971 6:91892221-91892243 CCCTCCACAATCCCCTTAAACAT No data
Right 1011870978 6:91892243-91892265 TTCCATTCCAGATCTCCTCAGGG No data
1011870971_1011870977 -2 Left 1011870971 6:91892221-91892243 CCCTCCACAATCCCCTTAAACAT No data
Right 1011870977 6:91892242-91892264 ATTCCATTCCAGATCTCCTCAGG No data
1011870971_1011870980 5 Left 1011870971 6:91892221-91892243 CCCTCCACAATCCCCTTAAACAT No data
Right 1011870980 6:91892249-91892271 TCCAGATCTCCTCAGGGAGATGG No data
1011870971_1011870982 13 Left 1011870971 6:91892221-91892243 CCCTCCACAATCCCCTTAAACAT No data
Right 1011870982 6:91892257-91892279 TCCTCAGGGAGATGGATTTTAGG No data
1011870971_1011870984 14 Left 1011870971 6:91892221-91892243 CCCTCCACAATCCCCTTAAACAT No data
Right 1011870984 6:91892258-91892280 CCTCAGGGAGATGGATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011870971 Original CRISPR ATGTTTAAGGGGATTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr