ID: 1011873991

View in Genome Browser
Species Human (GRCh38)
Location 6:91933435-91933457
Sequence AAAGCAGCCTATACCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011873987_1011873991 18 Left 1011873987 6:91933394-91933416 CCATGAAGGAGATTAGGTAGCAG No data
Right 1011873991 6:91933435-91933457 AAAGCAGCCTATACCCTGAAAGG No data
1011873986_1011873991 19 Left 1011873986 6:91933393-91933415 CCCATGAAGGAGATTAGGTAGCA No data
Right 1011873991 6:91933435-91933457 AAAGCAGCCTATACCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011873991 Original CRISPR AAAGCAGCCTATACCCTGAA AGG Intergenic
No off target data available for this crispr