ID: 1011880867

View in Genome Browser
Species Human (GRCh38)
Location 6:92024357-92024379
Sequence CATCATAAACAGAGGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011880859_1011880867 11 Left 1011880859 6:92024323-92024345 CCCCTGTTCCAGTGTCCTAGTCT No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data
1011880861_1011880867 9 Left 1011880861 6:92024325-92024347 CCTGTTCCAGTGTCCTAGTCTAC No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data
1011880863_1011880867 -4 Left 1011880863 6:92024338-92024360 CCTAGTCTACCACCTGCAGCATC No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data
1011880860_1011880867 10 Left 1011880860 6:92024324-92024346 CCCTGTTCCAGTGTCCTAGTCTA No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data
1011880858_1011880867 14 Left 1011880858 6:92024320-92024342 CCACCCCTGTTCCAGTGTCCTAG No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data
1011880862_1011880867 3 Left 1011880862 6:92024331-92024353 CCAGTGTCCTAGTCTACCACCTG No data
Right 1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011880867 Original CRISPR CATCATAAACAGAGGAATCT TGG Intergenic
No off target data available for this crispr