ID: 1011882711

View in Genome Browser
Species Human (GRCh38)
Location 6:92050559-92050581
Sequence GGCCCCTCCAATGAGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011882711_1011882713 -7 Left 1011882711 6:92050559-92050581 CCCATAGGCTCATTGGAGGGGCC No data
Right 1011882713 6:92050575-92050597 AGGGGCCAGTATGAGCTAGCTGG No data
1011882711_1011882714 -4 Left 1011882711 6:92050559-92050581 CCCATAGGCTCATTGGAGGGGCC No data
Right 1011882714 6:92050578-92050600 GGCCAGTATGAGCTAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011882711 Original CRISPR GGCCCCTCCAATGAGCCTAT GGG (reversed) Intergenic
No off target data available for this crispr