ID: 1011890716

View in Genome Browser
Species Human (GRCh38)
Location 6:92156162-92156184
Sequence TGATGATTGTAAGTATCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011890716_1011890721 21 Left 1011890716 6:92156162-92156184 CCTCAGGATACTTACAATCATCA No data
Right 1011890721 6:92156206-92156228 CGTCTTCTTCAGAAGGTGGCAGG No data
1011890716_1011890719 14 Left 1011890716 6:92156162-92156184 CCTCAGGATACTTACAATCATCA No data
Right 1011890719 6:92156199-92156221 AAGCAGGCGTCTTCTTCAGAAGG No data
1011890716_1011890718 -2 Left 1011890716 6:92156162-92156184 CCTCAGGATACTTACAATCATCA No data
Right 1011890718 6:92156183-92156205 CACAGAAGCAAAGGAAAAGCAGG No data
1011890716_1011890720 17 Left 1011890716 6:92156162-92156184 CCTCAGGATACTTACAATCATCA No data
Right 1011890720 6:92156202-92156224 CAGGCGTCTTCTTCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011890716 Original CRISPR TGATGATTGTAAGTATCCTG AGG (reversed) Intergenic
No off target data available for this crispr