ID: 1011890721

View in Genome Browser
Species Human (GRCh38)
Location 6:92156206-92156228
Sequence CGTCTTCTTCAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011890716_1011890721 21 Left 1011890716 6:92156162-92156184 CCTCAGGATACTTACAATCATCA No data
Right 1011890721 6:92156206-92156228 CGTCTTCTTCAGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011890721 Original CRISPR CGTCTTCTTCAGAAGGTGGC AGG Intergenic
No off target data available for this crispr