ID: 1011900713

View in Genome Browser
Species Human (GRCh38)
Location 6:92292370-92292392
Sequence CTATTTACAAAGGTGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011900713_1011900720 24 Left 1011900713 6:92292370-92292392 CCCAATCCCACCTTTGTAAATAG No data
Right 1011900720 6:92292417-92292439 AAATTTTTAAAATTTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011900713 Original CRISPR CTATTTACAAAGGTGGGATT GGG (reversed) Intergenic
No off target data available for this crispr