ID: 1011904093

View in Genome Browser
Species Human (GRCh38)
Location 6:92339330-92339352
Sequence CAAGATTCTCATTTTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011904093_1011904100 16 Left 1011904093 6:92339330-92339352 CCCATATCAAAATGAGAATCTTG No data
Right 1011904100 6:92339369-92339391 ACACAGCTGACCAGTGGGAGAGG No data
1011904093_1011904098 10 Left 1011904093 6:92339330-92339352 CCCATATCAAAATGAGAATCTTG No data
Right 1011904098 6:92339363-92339385 ATTTACACACAGCTGACCAGTGG No data
1011904093_1011904101 20 Left 1011904093 6:92339330-92339352 CCCATATCAAAATGAGAATCTTG No data
Right 1011904101 6:92339373-92339395 AGCTGACCAGTGGGAGAGGCTGG No data
1011904093_1011904102 24 Left 1011904093 6:92339330-92339352 CCCATATCAAAATGAGAATCTTG No data
Right 1011904102 6:92339377-92339399 GACCAGTGGGAGAGGCTGGCAGG No data
1011904093_1011904099 11 Left 1011904093 6:92339330-92339352 CCCATATCAAAATGAGAATCTTG No data
Right 1011904099 6:92339364-92339386 TTTACACACAGCTGACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011904093 Original CRISPR CAAGATTCTCATTTTGATAT GGG (reversed) Intergenic
No off target data available for this crispr