ID: 1011908947

View in Genome Browser
Species Human (GRCh38)
Location 6:92410490-92410512
Sequence CAACTTTTACAGCTTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011908947_1011908950 14 Left 1011908947 6:92410490-92410512 CCAGGTGGAAGCTGTAAAAGTTG No data
Right 1011908950 6:92410527-92410549 GTAGGCAAACACTTTCCAGAAGG No data
1011908947_1011908953 29 Left 1011908947 6:92410490-92410512 CCAGGTGGAAGCTGTAAAAGTTG No data
Right 1011908953 6:92410542-92410564 CCAGAAGGGATTTAGTGACCTGG No data
1011908947_1011908951 15 Left 1011908947 6:92410490-92410512 CCAGGTGGAAGCTGTAAAAGTTG No data
Right 1011908951 6:92410528-92410550 TAGGCAAACACTTTCCAGAAGGG No data
1011908947_1011908949 -4 Left 1011908947 6:92410490-92410512 CCAGGTGGAAGCTGTAAAAGTTG No data
Right 1011908949 6:92410509-92410531 GTTGAAGGTGCATCATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011908947 Original CRISPR CAACTTTTACAGCTTCCACC TGG (reversed) Intergenic
No off target data available for this crispr