ID: 1011917566

View in Genome Browser
Species Human (GRCh38)
Location 6:92526930-92526952
Sequence AGTTCATGGCAGTAGTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917566_1011917571 23 Left 1011917566 6:92526930-92526952 CCACACTACTACTGCCATGAACT No data
Right 1011917571 6:92526976-92526998 ACTTACAGACATCACTGACAAGG No data
1011917566_1011917567 -10 Left 1011917566 6:92526930-92526952 CCACACTACTACTGCCATGAACT No data
Right 1011917567 6:92526943-92526965 GCCATGAACTCCTGCAGCCTAGG No data
1011917566_1011917572 24 Left 1011917566 6:92526930-92526952 CCACACTACTACTGCCATGAACT No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917566 Original CRISPR AGTTCATGGCAGTAGTAGTG TGG (reversed) Intergenic