ID: 1011917566 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:92526930-92526952 |
| Sequence | AGTTCATGGCAGTAGTAGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011917566_1011917571 | 23 | Left | 1011917566 | 6:92526930-92526952 | CCACACTACTACTGCCATGAACT | No data | ||
| Right | 1011917571 | 6:92526976-92526998 | ACTTACAGACATCACTGACAAGG | No data | ||||
| 1011917566_1011917567 | -10 | Left | 1011917566 | 6:92526930-92526952 | CCACACTACTACTGCCATGAACT | No data | ||
| Right | 1011917567 | 6:92526943-92526965 | GCCATGAACTCCTGCAGCCTAGG | No data | ||||
| 1011917566_1011917572 | 24 | Left | 1011917566 | 6:92526930-92526952 | CCACACTACTACTGCCATGAACT | No data | ||
| Right | 1011917572 | 6:92526977-92526999 | CTTACAGACATCACTGACAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011917566 | Original CRISPR | AGTTCATGGCAGTAGTAGTG TGG (reversed) | Intergenic | ||