ID: 1011917568

View in Genome Browser
Species Human (GRCh38)
Location 6:92526944-92526966
Sequence ACCTAGGCTGCAGGAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917568_1011917572 10 Left 1011917568 6:92526944-92526966 CCATGAACTCCTGCAGCCTAGGT No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917568_1011917571 9 Left 1011917568 6:92526944-92526966 CCATGAACTCCTGCAGCCTAGGT No data
Right 1011917571 6:92526976-92526998 ACTTACAGACATCACTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917568 Original CRISPR ACCTAGGCTGCAGGAGTTCA TGG (reversed) Intergenic