ID: 1011917569

View in Genome Browser
Species Human (GRCh38)
Location 6:92526953-92526975
Sequence GCTTAAGTGACCTAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917569_1011917571 0 Left 1011917569 6:92526953-92526975 CCTGCAGCCTAGGTCACTTAAGC No data
Right 1011917571 6:92526976-92526998 ACTTACAGACATCACTGACAAGG No data
1011917569_1011917572 1 Left 1011917569 6:92526953-92526975 CCTGCAGCCTAGGTCACTTAAGC No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917569_1011917573 24 Left 1011917569 6:92526953-92526975 CCTGCAGCCTAGGTCACTTAAGC No data
Right 1011917573 6:92527000-92527022 TTACAGCTGAAGAAACTACATGG 0: 9
1: 16
2: 18
3: 98
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917569 Original CRISPR GCTTAAGTGACCTAGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr