ID: 1011917570

View in Genome Browser
Species Human (GRCh38)
Location 6:92526960-92526982
Sequence TGTAAGTGCTTAAGTGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917570_1011917572 -6 Left 1011917570 6:92526960-92526982 CCTAGGTCACTTAAGCACTTACA No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917570_1011917573 17 Left 1011917570 6:92526960-92526982 CCTAGGTCACTTAAGCACTTACA No data
Right 1011917573 6:92527000-92527022 TTACAGCTGAAGAAACTACATGG No data
1011917570_1011917571 -7 Left 1011917570 6:92526960-92526982 CCTAGGTCACTTAAGCACTTACA No data
Right 1011917571 6:92526976-92526998 ACTTACAGACATCACTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917570 Original CRISPR TGTAAGTGCTTAAGTGACCT AGG (reversed) Intergenic