ID: 1011917570 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:92526960-92526982 |
Sequence | TGTAAGTGCTTAAGTGACCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1011917570_1011917572 | -6 | Left | 1011917570 | 6:92526960-92526982 | CCTAGGTCACTTAAGCACTTACA | No data | ||
Right | 1011917572 | 6:92526977-92526999 | CTTACAGACATCACTGACAAGGG | No data | ||||
1011917570_1011917573 | 17 | Left | 1011917570 | 6:92526960-92526982 | CCTAGGTCACTTAAGCACTTACA | No data | ||
Right | 1011917573 | 6:92527000-92527022 | TTACAGCTGAAGAAACTACATGG | No data | ||||
1011917570_1011917571 | -7 | Left | 1011917570 | 6:92526960-92526982 | CCTAGGTCACTTAAGCACTTACA | No data | ||
Right | 1011917571 | 6:92526976-92526998 | ACTTACAGACATCACTGACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1011917570 | Original CRISPR | TGTAAGTGCTTAAGTGACCT AGG (reversed) | Intergenic | ||