ID: 1011917572

View in Genome Browser
Species Human (GRCh38)
Location 6:92526977-92526999
Sequence CTTACAGACATCACTGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917568_1011917572 10 Left 1011917568 6:92526944-92526966 CCATGAACTCCTGCAGCCTAGGT No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917570_1011917572 -6 Left 1011917570 6:92526960-92526982 CCTAGGTCACTTAAGCACTTACA No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917566_1011917572 24 Left 1011917566 6:92526930-92526952 CCACACTACTACTGCCATGAACT No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data
1011917569_1011917572 1 Left 1011917569 6:92526953-92526975 CCTGCAGCCTAGGTCACTTAAGC No data
Right 1011917572 6:92526977-92526999 CTTACAGACATCACTGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917572 Original CRISPR CTTACAGACATCACTGACAA GGG Intergenic