ID: 1011917573

View in Genome Browser
Species Human (GRCh38)
Location 6:92527000-92527022
Sequence TTACAGCTGAAGAAACTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011917569_1011917573 24 Left 1011917569 6:92526953-92526975 CCTGCAGCCTAGGTCACTTAAGC No data
Right 1011917573 6:92527000-92527022 TTACAGCTGAAGAAACTACATGG No data
1011917570_1011917573 17 Left 1011917570 6:92526960-92526982 CCTAGGTCACTTAAGCACTTACA No data
Right 1011917573 6:92527000-92527022 TTACAGCTGAAGAAACTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011917573 Original CRISPR TTACAGCTGAAGAAACTACA TGG Intergenic