ID: 1011927198

View in Genome Browser
Species Human (GRCh38)
Location 6:92661084-92661106
Sequence CATTACTACAAGAGGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011927198_1011927203 28 Left 1011927198 6:92661084-92661106 CCTCATGGCCTCTTGTAGTAATG No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011927198 Original CRISPR CATTACTACAAGAGGCCATG AGG (reversed) Intergenic
No off target data available for this crispr