ID: 1011927203

View in Genome Browser
Species Human (GRCh38)
Location 6:92661135-92661157
Sequence AGAATCCCATGATCTGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011927200_1011927203 -4 Left 1011927200 6:92661116-92661138 CCCTATACCTCTCATGTAGAGAA No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data
1011927199_1011927203 20 Left 1011927199 6:92661092-92661114 CCTCTTGTAGTAATGACTATTTT No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data
1011927198_1011927203 28 Left 1011927198 6:92661084-92661106 CCTCATGGCCTCTTGTAGTAATG No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data
1011927197_1011927203 29 Left 1011927197 6:92661083-92661105 CCCTCATGGCCTCTTGTAGTAAT No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data
1011927201_1011927203 -5 Left 1011927201 6:92661117-92661139 CCTATACCTCTCATGTAGAGAAT No data
Right 1011927203 6:92661135-92661157 AGAATCCCATGATCTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011927203 Original CRISPR AGAATCCCATGATCTGCAAT TGG Intergenic
No off target data available for this crispr