ID: 1011930904

View in Genome Browser
Species Human (GRCh38)
Location 6:92711272-92711294
Sequence CAGCATCTGCAACTTGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011930904_1011930906 -4 Left 1011930904 6:92711272-92711294 CCCAGTACAAGTTGCAGATGCTG No data
Right 1011930906 6:92711291-92711313 GCTGAAGTCCCTCATATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011930904 Original CRISPR CAGCATCTGCAACTTGTACT GGG (reversed) Intergenic
No off target data available for this crispr