ID: 1011931673

View in Genome Browser
Species Human (GRCh38)
Location 6:92722734-92722756
Sequence GGGTTCTTACAAATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011931673_1011931683 18 Left 1011931673 6:92722734-92722756 CCCTCCTCCATTTGTAAGAACCC No data
Right 1011931683 6:92722775-92722797 GCAACAATAATCTTATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011931673 Original CRISPR GGGTTCTTACAAATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr