ID: 1011934190

View in Genome Browser
Species Human (GRCh38)
Location 6:92754376-92754398
Sequence TCCATGGGGCCAATTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934190_1011934199 21 Left 1011934190 6:92754376-92754398 CCACCTCTAATTGGCCCCATGGA No data
Right 1011934199 6:92754420-92754442 CAGCTCAGCTTGGGGATGTCAGG No data
1011934190_1011934197 12 Left 1011934190 6:92754376-92754398 CCACCTCTAATTGGCCCCATGGA No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934190_1011934196 11 Left 1011934190 6:92754376-92754398 CCACCTCTAATTGGCCCCATGGA No data
Right 1011934196 6:92754410-92754432 CAGCTGATCACAGCTCAGCTTGG No data
1011934190_1011934198 13 Left 1011934190 6:92754376-92754398 CCACCTCTAATTGGCCCCATGGA No data
Right 1011934198 6:92754412-92754434 GCTGATCACAGCTCAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934190 Original CRISPR TCCATGGGGCCAATTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr