ID: 1011934193

View in Genome Browser
Species Human (GRCh38)
Location 6:92754390-92754412
Sequence CTGTTACAGCCTTCTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934193_1011934196 -3 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934196 6:92754410-92754432 CAGCTGATCACAGCTCAGCTTGG No data
1011934193_1011934197 -2 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934193_1011934199 7 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934199 6:92754420-92754442 CAGCTCAGCTTGGGGATGTCAGG No data
1011934193_1011934198 -1 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934198 6:92754412-92754434 GCTGATCACAGCTCAGCTTGGGG No data
1011934193_1011934200 24 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934200 6:92754437-92754459 GTCAGGCCACAAGTCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934193 Original CRISPR CTGTTACAGCCTTCTCCATG GGG (reversed) Intergenic
No off target data available for this crispr