ID: 1011934195

View in Genome Browser
Species Human (GRCh38)
Location 6:92754392-92754414
Sequence AGCTGTTACAGCCTTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934195_1011934200 22 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934200 6:92754437-92754459 GTCAGGCCACAAGTCTGTTGAGG No data
1011934195_1011934198 -3 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934198 6:92754412-92754434 GCTGATCACAGCTCAGCTTGGGG No data
1011934195_1011934202 30 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934202 6:92754445-92754467 ACAAGTCTGTTGAGGTTCAGTGG No data
1011934195_1011934197 -4 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934195_1011934196 -5 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934196 6:92754410-92754432 CAGCTGATCACAGCTCAGCTTGG No data
1011934195_1011934199 5 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934199 6:92754420-92754442 CAGCTCAGCTTGGGGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934195 Original CRISPR AGCTGTTACAGCCTTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr