ID: 1011934197

View in Genome Browser
Species Human (GRCh38)
Location 6:92754411-92754433
Sequence AGCTGATCACAGCTCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934191_1011934197 9 Left 1011934191 6:92754379-92754401 CCTCTAATTGGCCCCATGGAGAA No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934190_1011934197 12 Left 1011934190 6:92754376-92754398 CCACCTCTAATTGGCCCCATGGA No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934193_1011934197 -2 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934194_1011934197 -3 Left 1011934194 6:92754391-92754413 CCCATGGAGAAGGCTGTAACAGC No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data
1011934195_1011934197 -4 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934197 6:92754411-92754433 AGCTGATCACAGCTCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934197 Original CRISPR AGCTGATCACAGCTCAGCTT GGG Intergenic
No off target data available for this crispr