ID: 1011934200

View in Genome Browser
Species Human (GRCh38)
Location 6:92754437-92754459
Sequence GTCAGGCCACAAGTCTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934193_1011934200 24 Left 1011934193 6:92754390-92754412 CCCCATGGAGAAGGCTGTAACAG No data
Right 1011934200 6:92754437-92754459 GTCAGGCCACAAGTCTGTTGAGG No data
1011934195_1011934200 22 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934200 6:92754437-92754459 GTCAGGCCACAAGTCTGTTGAGG No data
1011934194_1011934200 23 Left 1011934194 6:92754391-92754413 CCCATGGAGAAGGCTGTAACAGC No data
Right 1011934200 6:92754437-92754459 GTCAGGCCACAAGTCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934200 Original CRISPR GTCAGGCCACAAGTCTGTTG AGG Intergenic
No off target data available for this crispr