ID: 1011934202

View in Genome Browser
Species Human (GRCh38)
Location 6:92754445-92754467
Sequence ACAAGTCTGTTGAGGTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011934195_1011934202 30 Left 1011934195 6:92754392-92754414 CCATGGAGAAGGCTGTAACAGCT No data
Right 1011934202 6:92754445-92754467 ACAAGTCTGTTGAGGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011934202 Original CRISPR ACAAGTCTGTTGAGGTTCAG TGG Intergenic
No off target data available for this crispr