ID: 1011940928

View in Genome Browser
Species Human (GRCh38)
Location 6:92842272-92842294
Sequence GCTTTGAAGGGGAAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011940928_1011940933 5 Left 1011940928 6:92842272-92842294 CCAAGCTCCTTCCCCTTCAAAGC No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011940928 Original CRISPR GCTTTGAAGGGGAAGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr