ID: 1011940929

View in Genome Browser
Species Human (GRCh38)
Location 6:92842279-92842301
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011940929_1011940933 -2 Left 1011940929 6:92842279-92842301 CCTTCCCCTTCAAAGCTTCTGCA No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011940929 Original CRISPR TGCAGAAGCTTTGAAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr