ID: 1011940933

View in Genome Browser
Species Human (GRCh38)
Location 6:92842300-92842322
Sequence CACATTATACTTCCTCTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011940929_1011940933 -2 Left 1011940929 6:92842279-92842301 CCTTCCCCTTCAAAGCTTCTGCA No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940926_1011940933 16 Left 1011940926 6:92842261-92842283 CCTCAGGCCTGCCAAGCTCCTTC No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940927_1011940933 9 Left 1011940927 6:92842268-92842290 CCTGCCAAGCTCCTTCCCCTTCA No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940930_1011940933 -6 Left 1011940930 6:92842283-92842305 CCCCTTCAAAGCTTCTGCACATT No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940924_1011940933 30 Left 1011940924 6:92842247-92842269 CCAGCCACACTGTTCCTCAGGCC No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940928_1011940933 5 Left 1011940928 6:92842272-92842294 CCAAGCTCCTTCCCCTTCAAAGC No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940931_1011940933 -7 Left 1011940931 6:92842284-92842306 CCCTTCAAAGCTTCTGCACATTA No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940932_1011940933 -8 Left 1011940932 6:92842285-92842307 CCTTCAAAGCTTCTGCACATTAT No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data
1011940925_1011940933 26 Left 1011940925 6:92842251-92842273 CCACACTGTTCCTCAGGCCTGCC No data
Right 1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011940933 Original CRISPR CACATTATACTTCCTCTACC CGG Intergenic
No off target data available for this crispr