ID: 1011946491

View in Genome Browser
Species Human (GRCh38)
Location 6:92911023-92911045
Sequence GTAGGCTTGTGCCCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011946490_1011946491 -7 Left 1011946490 6:92911007-92911029 CCAAACACTTTCACAGGTAGGCT No data
Right 1011946491 6:92911023-92911045 GTAGGCTTGTGCCCAAAACCAGG No data
1011946487_1011946491 28 Left 1011946487 6:92910972-92910994 CCTAAGTCTATGCAGTTGAGGTA No data
Right 1011946491 6:92911023-92911045 GTAGGCTTGTGCCCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011946491 Original CRISPR GTAGGCTTGTGCCCAAAACC AGG Intergenic
No off target data available for this crispr