ID: 1011947391

View in Genome Browser
Species Human (GRCh38)
Location 6:92923297-92923319
Sequence AGTATTTACCAGGATTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011947391_1011947396 28 Left 1011947391 6:92923297-92923319 CCCTCCAAATCCTGGTAAATACT No data
Right 1011947396 6:92923348-92923370 CCATTTTAAGTAGTTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011947391 Original CRISPR AGTATTTACCAGGATTTGGA GGG (reversed) Intergenic
No off target data available for this crispr