ID: 1011966445

View in Genome Browser
Species Human (GRCh38)
Location 6:93163814-93163836
Sequence CTAAAGGTACAGATTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011966445_1011966447 -9 Left 1011966445 6:93163814-93163836 CCTCCATGAATCTGTACCTTTAG No data
Right 1011966447 6:93163828-93163850 TACCTTTAGTTTATCCTGTGTGG No data
1011966445_1011966452 21 Left 1011966445 6:93163814-93163836 CCTCCATGAATCTGTACCTTTAG No data
Right 1011966452 6:93163858-93163880 ATATACTTTTTTAAAAACTTGGG No data
1011966445_1011966451 20 Left 1011966445 6:93163814-93163836 CCTCCATGAATCTGTACCTTTAG No data
Right 1011966451 6:93163857-93163879 TATATACTTTTTTAAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011966445 Original CRISPR CTAAAGGTACAGATTCATGG AGG (reversed) Intergenic
No off target data available for this crispr