ID: 1011966912

View in Genome Browser
Species Human (GRCh38)
Location 6:93171244-93171266
Sequence TGCAAGTTAGATCACTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011966912_1011966913 -1 Left 1011966912 6:93171244-93171266 CCACTGAAGTGATCTAACTTGCA No data
Right 1011966913 6:93171266-93171288 AAAGACTTTTCTCTTTTGCCAGG No data
1011966912_1011966915 17 Left 1011966912 6:93171244-93171266 CCACTGAAGTGATCTAACTTGCA No data
Right 1011966915 6:93171284-93171306 CCAGGACTTTTCTTTTGCTCTGG No data
1011966912_1011966916 24 Left 1011966912 6:93171244-93171266 CCACTGAAGTGATCTAACTTGCA No data
Right 1011966916 6:93171291-93171313 TTTTCTTTTGCTCTGGCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011966912 Original CRISPR TGCAAGTTAGATCACTTCAG TGG (reversed) Intergenic
No off target data available for this crispr