ID: 1011971704

View in Genome Browser
Species Human (GRCh38)
Location 6:93233088-93233110
Sequence ACCCACCTCCTGTAACCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011971703_1011971704 6 Left 1011971703 6:93233059-93233081 CCAGGCAGCTTACACAAGTACTG No data
Right 1011971704 6:93233088-93233110 ACCCACCTCCTGTAACCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011971704 Original CRISPR ACCCACCTCCTGTAACCTAG AGG Intergenic
No off target data available for this crispr