ID: 1011972132

View in Genome Browser
Species Human (GRCh38)
Location 6:93238812-93238834
Sequence AACAGCTGGTAGGAGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011972126_1011972132 28 Left 1011972126 6:93238761-93238783 CCTGCCCACATTCTTTAAGCTAT No data
Right 1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG No data
1011972127_1011972132 24 Left 1011972127 6:93238765-93238787 CCCACATTCTTTAAGCTATGCTG No data
Right 1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG No data
1011972128_1011972132 23 Left 1011972128 6:93238766-93238788 CCACATTCTTTAAGCTATGCTGA No data
Right 1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011972132 Original CRISPR AACAGCTGGTAGGAGTGTGT GGG Intergenic
No off target data available for this crispr