ID: 1011974907

View in Genome Browser
Species Human (GRCh38)
Location 6:93283639-93283661
Sequence GCTCCTGGTCTCGCTGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1395
Summary {0: 2, 1: 4, 2: 73, 3: 652, 4: 664}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011974907 Original CRISPR GCTCCTGGTCTCGCTGGCTT CGG (reversed) Intronic
900113080 1:1017320-1017342 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
900422896 1:2563291-2563313 GCTCCAGGTATCTCTGGCGTCGG - Exonic
901045836 1:6395192-6395214 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
901432560 1:9225934-9225956 GCACCTGGACTCGGTGGCTCAGG + Intergenic
901601327 1:10425806-10425828 GCTCGTGGTCTCACTGGCTCAGG + Intergenic
901783493 1:11609647-11609669 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
902033600 1:13440224-13440246 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
902100257 1:13982392-13982414 GTTCGTGGTCTAGCTGGCTCAGG + Intergenic
902963817 1:19983852-19983874 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
903562328 1:24237219-24237241 GCTCCTCTTCCCCCTGGCTTGGG - Intergenic
904330228 1:29753891-29753913 GCTCCTGGTCTAGCAGGGTTGGG + Intergenic
904874358 1:33642897-33642919 GCTCCTGGTCTCTCTGCCTTGGG + Intronic
905186065 1:36197696-36197718 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
905375802 1:37519387-37519409 GTTCGTGGTCTCGCTGGCTGAGG - Intergenic
905682294 1:39882895-39882917 TATCCTGATCTCGCTGGGTTAGG + Intronic
905743064 1:40388981-40389003 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
906082971 1:43106496-43106518 GTTCGTGTTCTCGCTGGCTCAGG + Intergenic
906563329 1:46777637-46777659 GTTCATGGTCTCGCTGGCTCAGG + Intronic
906876287 1:49542379-49542401 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
907396657 1:54195443-54195465 GCTCCTGTCCTTGCTGGCTTGGG + Exonic
907759347 1:57342736-57342758 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
907889670 1:58624662-58624684 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
907980235 1:59473319-59473341 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
908291511 1:62671083-62671105 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
908439571 1:64140354-64140376 GCTTCTGGGCTCTCTGGCTGGGG - Exonic
909318390 1:74252638-74252660 GTTCGTGGTCTCGCTGGCTATGG + Intronic
909376922 1:74951375-74951397 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
909608584 1:77531168-77531190 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
909759426 1:79270294-79270316 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
909904408 1:81177934-81177956 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
910034603 1:82776068-82776090 GTTCGTGGTCTCGCTGGCTGAGG + Intergenic
910334499 1:86111756-86111778 GTTCGTGGTCTCGCTGGCCTCGG - Intronic
910622509 1:89272603-89272625 GTTCGTGGTCTGGCTGGCTCAGG + Intronic
910692994 1:89984037-89984059 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
911001587 1:93171242-93171264 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
911259427 1:95668886-95668908 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
911435852 1:97856837-97856859 TCTCCTGGTATCTCTGGCATTGG + Intronic
911839063 1:102659138-102659160 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
911954323 1:104216492-104216514 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
912057937 1:105630287-105630309 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
912082786 1:105958220-105958242 GAGCATGGTCTCGCTGACTTTGG + Intergenic
912166348 1:107045999-107046021 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
912316084 1:108668549-108668571 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
912538601 1:110395570-110395592 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
912759456 1:112354173-112354195 GCTCCTGTTCTCCATGGCCTGGG - Intergenic
912819214 1:112853802-112853824 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
912939956 1:114036061-114036083 GCTCCAGGTCTTTCTAGCTTTGG + Intergenic
913050404 1:115112620-115112642 CCTCAGAGTCTCGCTGGCTTAGG - Intergenic
913078666 1:115361515-115361537 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
913160891 1:116145721-116145743 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
913469158 1:119172537-119172559 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
913470359 1:119180219-119180241 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
913486319 1:119335131-119335153 GTTCCTGGTCTCGCTGACTCAGG - Intergenic
913691910 1:121287791-121287813 GTTCATGGTCTCGCTGGCTCAGG + Intronic
914145637 1:144992163-144992185 GTTCGTGGTCTCACTGGCTCAGG - Intronic
915260227 1:154671828-154671850 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
915665942 1:157445589-157445611 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
915675113 1:157522656-157522678 GCTCCTGGTCTCTATGACCTGGG + Intronic
915764328 1:158348274-158348296 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
915766986 1:158373282-158373304 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
916909921 1:169336086-169336108 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
916939180 1:169662247-169662269 GTTCATGGTCTCGCTGGCTCAGG - Intronic
916940238 1:169669245-169669267 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
916960437 1:169883082-169883104 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
917446151 1:175107256-175107278 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
917446166 1:175107387-175107409 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
917578410 1:176348690-176348712 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
917860574 1:179139351-179139373 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
917932825 1:179836224-179836246 GTTCGTGGTCTCGCTGGCTTAGG + Intergenic
918659556 1:187072751-187072773 GTTCGTGATCTCGCTGGCTCAGG + Intergenic
918659571 1:187072882-187072904 GTTCGTGATCTCGCTGGCTCAGG + Intergenic
918659585 1:187072980-187073002 GTTCGTGATCTCGCTGGCTCAGG + Intergenic
918659598 1:187073111-187073133 GTTCGTGATCTCGCTGGCTCAGG + Intergenic
918709107 1:187704682-187704704 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
918720997 1:187851293-187851315 GTTCGTGATCTCGCTGGCTCAGG - Intergenic
918732144 1:188012621-188012643 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
918732157 1:188012722-188012744 GCTCCTGGTCTCGCTGGCTTCGG + Intergenic
918790142 1:188814355-188814377 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
918791869 1:188840393-188840415 GTTCACGGTCTCGCTGGCTCAGG + Intergenic
918853060 1:189717687-189717709 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
918952132 1:191152253-191152275 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
918994039 1:191732773-191732795 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
919092055 1:192987882-192987904 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
919174630 1:194002872-194002894 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
919237186 1:194860074-194860096 GTTCCTGGTCTCCCTGGCTCAGG - Intergenic
919250998 1:195055473-195055495 GTTCATGGCCTCGCTGGCTCAGG - Intergenic
919297607 1:195722114-195722136 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
920150377 1:203901190-203901212 ATTCGTGGTCTCGCTGGCTCAGG - Intergenic
920336710 1:205249795-205249817 GCTGCTGGTCTGGCTGCCTCTGG - Intronic
920479243 1:206306299-206306321 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
920731209 1:208487724-208487746 GTTCATAGTCTCGCTGGCTCAGG + Intergenic
920756845 1:208740748-208740770 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
921094254 1:211873551-211873573 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
921396213 1:214672434-214672456 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
921396226 1:214672535-214672557 GCTCCTGGTCTCGCTGGCTCAGG + Intergenic
921801969 1:219411740-219411762 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
921886800 1:220315200-220315222 GGTCCTGGCCCAGCTGGCTTTGG + Intergenic
921983508 1:221284947-221284969 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
922306819 1:224351801-224351823 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
922423371 1:225473726-225473748 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
922485603 1:225971046-225971068 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
922855940 1:228774676-228774698 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
922986050 1:229866649-229866671 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
923172450 1:231430075-231430097 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
923324658 1:232870771-232870793 CTTCGTGGTCTCGCTGGCTCAGG + Intergenic
923355404 1:233150084-233150106 GGTCCTGGCCCCGCTGGCTGTGG - Intronic
923574029 1:235141807-235141829 GTTCGTGGTCTCACTGGCTCAGG - Intronic
923623072 1:235593677-235593699 GTTCATGGTCTCGCTGGCTCAGG + Intronic
923929899 1:238683767-238683789 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
924117685 1:240763523-240763545 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
924865738 1:247978193-247978215 GTTCGTGGTCTCACTGACTTGGG - Intronic
1063094682 10:2899075-2899097 TCTGCTGGTCTCTGTGGCTTGGG - Intergenic
1063148782 10:3319045-3319067 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1063300223 10:4844192-4844214 GTTCATGGTCTCACTGGCTTAGG + Intronic
1063309160 10:4936752-4936774 GTTCATGGTCTCGCTGGCTTAGG + Intronic
1063322044 10:5059994-5060016 GTGCATGGTCTCGCTGGCTCAGG + Intronic
1063769861 10:9184381-9184403 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1063848886 10:10162162-10162184 GTTCGTGGTCTCGCTGACTTCGG - Intergenic
1064449039 10:15425350-15425372 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1064461195 10:15536017-15536039 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1064757660 10:18586513-18586535 GTTCGTGGTCTTGCTGACTTGGG + Intronic
1065425606 10:25599586-25599608 TCTCCTGGTTTACCTGGCTTAGG - Exonic
1065441491 10:25756883-25756905 GTTCGTCGTCTCGCTGGCTCAGG - Intergenic
1065743138 10:28815170-28815192 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1065802792 10:29367504-29367526 GTTCGTGGTCTCTCTGGCTCAGG - Intergenic
1065896044 10:30163886-30163908 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1065995694 10:31057157-31057179 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1066012605 10:31208705-31208727 CCTCCTACTCTCCCTGGCTTTGG - Intergenic
1066190449 10:33050518-33050540 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1066234227 10:33469230-33469252 GTTCGTGGTCTCGCTAGCTCAGG - Intergenic
1066567231 10:36733786-36733808 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1067363352 10:45601765-45601787 GTTCCTGGTCTCGCTGGCTTAGG - Intergenic
1068191685 10:53660228-53660250 GTTCCTGGTCTGGCTGGCTCAGG + Intergenic
1068418285 10:56754761-56754783 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1068460525 10:57322500-57322522 GTTTGTGGTCTCGCTGGCTCCGG - Intergenic
1068863350 10:61868851-61868873 GTTCCTGGTCTCGCTAGCTCAGG - Intergenic
1069186352 10:65428643-65428665 ATTCGTGGTCTCGCTGGCTCAGG + Intergenic
1069215186 10:65811384-65811406 GTTCGCGGTCTCGCTGGCTCAGG + Intergenic
1069215202 10:65811485-65811507 GTTCGTGGTCTCGCTGGCTTCGG + Intergenic
1069766305 10:70862735-70862757 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1069988851 10:72301743-72301765 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
1069988868 10:72301845-72301867 GTTCGTTGTCTCGCTGGCTCAGG - Intergenic
1069993125 10:72327006-72327028 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1070172886 10:73945790-73945812 GCTCGTGGTTTCGCTGGCTCAGG - Intergenic
1070563946 10:77589712-77589734 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1070938038 10:80316454-80316476 GTTCATGGTCTCACTGGCTCAGG - Intergenic
1070968469 10:80544286-80544308 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1070973550 10:80586957-80586979 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1071055844 10:81506818-81506840 GTTCGTGGTCTTGCTGGCTGAGG - Intergenic
1071388156 10:85142370-85142392 GCTGGTGGTCTCGCTGGCTCAGG - Intergenic
1071388169 10:85142471-85142493 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1071796925 10:89017905-89017927 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1071900858 10:90119218-90119240 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1071963616 10:90831318-90831340 GTTCATGGTCTCGCTGACTCAGG + Intronic
1072206408 10:93208816-93208838 AGTCCTGGCCTGGCTGGCTTTGG + Intergenic
1072372059 10:94773692-94773714 GTTTGTGGTCTTGCTGGCTTTGG + Intronic
1073262316 10:102199927-102199949 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1073789594 10:106927277-106927299 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
1073878482 10:107951917-107951939 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1074732616 10:116394325-116394347 CTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1074732631 10:116394457-116394479 GTTGGTGGTCTCGCTGGCTCAGG - Intergenic
1074732646 10:116394579-116394601 GTTCGTGGTCTCTCTGGCTCAGG - Intergenic
1074996166 10:118759286-118759308 GATCATGGTCTCGCTGGCTCAGG + Intergenic
1074999405 10:118784052-118784074 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1075035875 10:119066699-119066721 GCTCCAGGGCTCGCAGTCTTTGG - Intronic
1075255774 10:120924795-120924817 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
1075307788 10:121383191-121383213 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
1075537350 10:123282642-123282664 GTTCGTGGTCTCGCCGGCTCAGG + Intergenic
1076261439 10:129070134-129070156 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1076773736 10:132681416-132681438 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1076796387 10:132800336-132800358 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1077342511 11:2032329-2032351 GCTCCCGGTGTGGCTGGCGTTGG + Intergenic
1077603388 11:3589766-3589788 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1077764754 11:5145446-5145468 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1077778019 11:5293411-5293433 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1077805913 11:5590847-5590869 GTTCGTGGTCTCGCTAGCTCAGG - Exonic
1077815761 11:5684008-5684030 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1078150148 11:8751545-8751567 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1078251730 11:9622202-9622224 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1078301026 11:10132471-10132493 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1078795985 11:14592095-14592117 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1079190816 11:18275387-18275409 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
1079555268 11:21752589-21752611 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1079726061 11:23882750-23882772 GTTCCTGGTCTTGCTGGCTCAGG + Intergenic
1079730425 11:23934079-23934101 GTTCGTGGTCTCGCTGGCTTAGG + Intergenic
1079731589 11:23941562-23941584 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1079756663 11:24273611-24273633 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1080107345 11:28524957-28524979 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1080138988 11:28891811-28891833 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1080195061 11:29599577-29599599 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1080204602 11:29713912-29713934 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1080557533 11:33431029-33431051 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1080621619 11:33991403-33991425 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1080925014 11:36747250-36747272 GCACCTGGTCCCTCTGACTTGGG + Intergenic
1081125245 11:39313183-39313205 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1081315352 11:41623955-41623977 GTTCATGGTCTCGCTGTCTCAGG - Intergenic
1081329545 11:41787392-41787414 GTTCGTGGTTTCGCTGGCTCAGG + Intergenic
1081421088 11:42875223-42875245 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1082270274 11:50163167-50163189 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1082272298 11:50184494-50184516 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
1082698599 11:56401240-56401262 GTTCGTGGTCTCGCTGGCTGAGG + Intergenic
1083074138 11:60019536-60019558 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1083074150 11:60019637-60019659 GTTCGTGGTCTGGCTGGCTTCGG + Intergenic
1083546295 11:63551416-63551438 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1084024570 11:66439976-66439998 GTTCATGGTCTCGATGGCTCAGG + Intronic
1084107584 11:66989975-66989997 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1084210645 11:67620251-67620273 GTTCGTGGTCTCGCTGGCTTAGG - Intergenic
1084211641 11:67626870-67626892 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1084259287 11:67964311-67964333 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1084406017 11:68974021-68974043 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1084813486 11:71630870-71630892 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1085376052 11:76061649-76061671 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1085447071 11:76608076-76608098 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1085670914 11:78464102-78464124 GTTCGTGGTCTGGCTGGCTCAGG + Intronic
1085863306 11:80258645-80258667 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1086043201 11:82502362-82502384 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1086209953 11:84307824-84307846 GTTCGTGGTCTCGCTGACTCAGG + Intronic
1086397579 11:86432731-86432753 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1086808191 11:91269902-91269924 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1087486204 11:98762533-98762555 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1087966377 11:104421457-104421479 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1088481561 11:110300293-110300315 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1089061960 11:115633121-115633143 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1089373412 11:117977817-117977839 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1089800392 11:121022631-121022653 GTTAGTGGTCTCGCTGGCTCCGG - Intergenic
1090307510 11:125703911-125703933 GTTCGTGGTCTCGCTAGCTCAGG + Intergenic
1090588411 11:128238175-128238197 GTTCGTAGTCTCGCTGGCTCAGG - Intergenic
1090776559 11:129971102-129971124 GTTCATGGTCTCGCTGGTTCAGG + Intronic
1091201379 11:133783477-133783499 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1091233288 11:134002215-134002237 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1202825497 11_KI270721v1_random:87518-87540 GCTCCCGGTGTGGCTGGCGTTGG + Intergenic
1092106940 12:5927990-5928012 TCTCCTGGTCTCCTTGGCTTTGG - Intronic
1092137595 12:6160519-6160541 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1092221553 12:6717125-6717147 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
1092273095 12:7038607-7038629 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1092364203 12:7863260-7863282 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1092471959 12:8788496-8788518 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1092473154 12:8795955-8795977 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1092477450 12:8831183-8831205 GCTCCTGGCCTCTCTCGCTTTGG + Intronic
1092572261 12:9738904-9738926 GTTCGGGGTCTCGCTGGCTCAGG + Intergenic
1092583668 12:9875459-9875481 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1092616959 12:10224666-10224688 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1092834070 12:12471770-12471792 GTTCGTGGTGTCGCTGGCTCAGG + Intergenic
1093034698 12:14321389-14321411 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1093172494 12:15875618-15875640 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1093189571 12:16058450-16058472 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1093266663 12:17011559-17011581 GTTCATAGTCTCGCTGGCTCAGG - Intergenic
1093346398 12:18041269-18041291 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1093381705 12:18501006-18501028 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1093526920 12:20114397-20114419 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1093580040 12:20776752-20776774 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1093580878 12:20783068-20783090 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1093793855 12:23286785-23286807 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1093921819 12:24867135-24867157 GTTCGTGGTCTCGTTGGCTCAGG - Intronic
1093973112 12:25392410-25392432 GTTTCTGGTCTCGCTGGCTCAGG - Intergenic
1094327725 12:29257717-29257739 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1094338444 12:29385513-29385535 GTTCATGGTCTCGCTGGCTCGGG + Intergenic
1094405188 12:30109619-30109641 GTTCATGGTTTCGCTGGCTCAGG + Intergenic
1094410042 12:30158161-30158183 GTTCGTAGTCTCGCTGGCTCAGG - Intergenic
1094448892 12:30562826-30562848 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1094589124 12:31804820-31804842 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1094661458 12:32473483-32473505 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1094722212 12:33076499-33076521 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1095123264 12:38443179-38443201 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1095304300 12:40621630-40621652 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1095478486 12:42610223-42610245 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1095776874 12:46019146-46019168 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1095901707 12:47334468-47334490 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1095901720 12:47334569-47334591 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1096220613 12:49826386-49826408 ACTCCTGCTCCTGCTGGCTTGGG - Intronic
1097128774 12:56795006-56795028 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1097598989 12:61668987-61669009 GCTCCTGGTCTCTCTTCCTGTGG - Intergenic
1097982174 12:65745557-65745579 GTTCGTGGTCTCGCTAGCTCAGG - Intergenic
1098168055 12:67718504-67718526 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1098498584 12:71165329-71165351 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
1098516073 12:71377469-71377491 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1098588872 12:72186430-72186452 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1099191547 12:79565970-79565992 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1099192578 12:79574888-79574910 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1099227998 12:79992670-79992692 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
1099443997 12:82729985-82730007 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1099523750 12:83695224-83695246 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1099790768 12:87330621-87330643 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1100142551 12:91635380-91635402 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1100166454 12:91923190-91923212 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1100521621 12:95380749-95380771 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1100734469 12:97512132-97512154 ATTCGTGGTCTCGCTGGCTCAGG + Intergenic
1101021797 12:100560532-100560554 GTTCATGGTCTCGCTGGCTCAGG - Intronic
1101461791 12:104904678-104904700 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1102387086 12:112519210-112519232 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1102904167 12:116661754-116661776 GTTCGTGATCTCGCTGGCTCAGG - Intergenic
1103009310 12:117445903-117445925 GCTCTTGGTCTCACTGACTTGGG - Intronic
1103145978 12:118596367-118596389 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1103497717 12:121375640-121375662 GTTCCTGGTCTCGCTGGCTCAGG - Intronic
1103668696 12:122593048-122593070 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1103678554 12:122675916-122675938 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1103783225 12:123413399-123413421 GTTCGTGATCTCGCTGGCTCAGG + Exonic
1104582816 12:130023246-130023268 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1104614342 12:130255866-130255888 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1104749427 12:131229039-131229061 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1104749438 12:131229140-131229162 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1105037908 12:132939843-132939865 GCTCGTGGTCTCGCTGGCTCAGG - Intronic
1105037921 12:132939943-132939965 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1105722348 13:23128924-23128946 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1105868197 13:24480012-24480034 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1105876514 13:24559873-24559895 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1105883613 13:24624412-24624434 GTTCGTGGTCTCGCTAGCTCAGG - Intergenic
1105968243 13:25404253-25404275 GCTTCTGGTCACCTTGGCTTTGG - Intronic
1106125434 13:26896967-26896989 GGTCCTGGTCTTGTTGGGTTAGG + Intergenic
1106221134 13:27747319-27747341 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1106600392 13:31182341-31182363 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1107398257 13:40041338-40041360 GTTCGTGGTCTTGCTGACTTCGG - Intergenic
1107632878 13:42360385-42360407 GCTCCTGTCCTAGCTGCCTTGGG + Intergenic
1108099011 13:46935263-46935285 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1108435507 13:50397660-50397682 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1108469296 13:50752595-50752617 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1108643815 13:52407356-52407378 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
1108685298 13:52814385-52814407 GTTGGTGGTCTCGCTGGCTCAGG + Intergenic
1108851459 13:54736636-54736658 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1108856409 13:54799282-54799304 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1108858774 13:54828547-54828569 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1108858784 13:54828648-54828670 GCTCATGATCTTGCTGGCTTCGG + Intergenic
1109110874 13:58317978-58318000 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1109141201 13:58715168-58715190 GTTCGTGGTCTCGCTGGCTGAGG - Intergenic
1109202050 13:59441396-59441418 GTTCTTGGTCTCGCTGGCTCAGG - Intergenic
1109441529 13:62380279-62380301 GTTCGTGGTCTCGCTGCCTCAGG - Intergenic
1109446467 13:62447338-62447360 GTTCCTGGTCTCACTGCCTTAGG + Intergenic
1109563014 13:64076930-64076952 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1109741668 13:66561996-66562018 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
1110223138 13:73093856-73093878 GCTCCTGGTTTCCCTGACTCTGG - Intergenic
1110417643 13:75269599-75269621 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1110609646 13:77474628-77474650 GTTCCTGGTCTCACTGGCTCAGG + Intergenic
1110660504 13:78055151-78055173 GTTTGTGGTCTTGCTGGCTTAGG + Intergenic
1110751245 13:79118964-79118986 GTTCGTGGTCTCGGTGGCTCAGG + Intergenic
1110792245 13:79599472-79599494 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1110862281 13:80356497-80356519 TATCGTGGTCTCGCTGGCTTCGG - Intergenic
1110874199 13:80489894-80489916 GTTCGTGGTCTCGTTGGCTCAGG + Intergenic
1110940107 13:81339941-81339963 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1111006848 13:82259406-82259428 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
1111138635 13:84085658-84085680 GTTCCTGGTCTCACTGGCCTCGG + Intergenic
1111239916 13:85459954-85459976 GTTCATGGTCTCGCTGACTTAGG - Intergenic
1111333712 13:86793183-86793205 GTTCGTGATCTCGCTGGCCTCGG - Intergenic
1111442065 13:88292910-88292932 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1111602878 13:90495863-90495885 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1111602892 13:90495965-90495987 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1111602905 13:90496066-90496088 GTTCGCGGTCTCGCTGGCTCAGG - Intergenic
1112282537 13:98075609-98075631 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1112518802 13:100078588-100078610 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1112533010 13:100223376-100223398 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
1112613277 13:100976870-100976892 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1112706027 13:102069664-102069686 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1113249698 13:108438281-108438303 GCAGCTGGTCTCCCTGCCTTTGG + Intergenic
1113371799 13:109731892-109731914 GTTCCTGGTCTCTCTGGCTCAGG + Intergenic
1113506789 13:110822249-110822271 GCTCGTGGTCTCGCTCGGTTCGG - Intergenic
1113506803 13:110822350-110822372 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1113537969 13:111083184-111083206 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1113678205 13:112222751-112222773 GTTCATGGTCTCACTGGCTCAGG - Intergenic
1114155683 14:20100083-20100105 GTTCGTGGTCTCTCTGGCTCAGG - Intergenic
1114560147 14:23584050-23584072 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1114593708 14:23892950-23892972 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1115202999 14:30874187-30874209 GCTCCAGGCCTCGCTGGGTGGGG + Intergenic
1115533108 14:34345188-34345210 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1116223047 14:42112795-42112817 GTTCGTGGTCTCGCTGGATGAGG + Intergenic
1116390684 14:44385683-44385705 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1116426756 14:44799900-44799922 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1116624180 14:47243635-47243657 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1116624272 14:47244877-47244899 GCACTTGGTCTTGCTGTCTTAGG - Intronic
1116653956 14:47627859-47627881 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1116657157 14:47666943-47666965 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
1117078029 14:52123317-52123339 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1117297724 14:54394479-54394501 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1117449967 14:55840491-55840513 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1117565793 14:56992091-56992113 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1117571756 14:57055786-57055808 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1118215234 14:63802760-63802782 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1118384430 14:65243996-65244018 GCTCCTTGGCTTTCTGGCTTGGG - Intergenic
1118877017 14:69794411-69794433 GCTCCAGGTCTGGGTGGCTCCGG - Intronic
1118932577 14:70255976-70255998 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1119027931 14:71168518-71168540 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1119039007 14:71255381-71255403 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1119300162 14:73565618-73565640 GTTCATGGTCTCGCTGGCTTAGG + Intergenic
1119673302 14:76536137-76536159 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1119694958 14:76706057-76706079 GATCATGGTCTCGTTGGCTCAGG + Intergenic
1119870539 14:78013186-78013208 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1120209693 14:81622805-81622827 GTTCATGGTCTGGCTGGCTCAGG + Intergenic
1120331145 14:83093613-83093635 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1120438903 14:84511816-84511838 GTTCGTGGTCTGGCTGGCTCAGG + Intergenic
1120438930 14:84512078-84512100 GTTCGCGGTCTCGCTGGCTCAGG + Intergenic
1121663132 14:95650716-95650738 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1121906701 14:97752692-97752714 GCTGCTGGTCCTGCTGGCTCTGG - Intronic
1122216377 14:100207470-100207492 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1122315925 14:100826145-100826167 GCGCCTTGGCTCGCTGGCCTTGG + Intergenic
1122493276 14:102134574-102134596 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1122531628 14:102431913-102431935 GCTCCTTGGCTCGCTGGCCACGG - Exonic
1123799308 15:23803987-23804009 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1123931004 15:25171650-25171672 GCCCTGGGACTCGCTGGCTTTGG + Intergenic
1124036528 15:26058080-26058102 GTTCACGGTCTCGCTGGCTCAGG - Intergenic
1124114670 15:26830305-26830327 GTTTCTGGTCTCGCTGGCTCAGG + Intronic
1124114685 15:26830406-26830428 GCTTGTGGTCTCGCTGGCTTCGG + Intronic
1124380209 15:29159192-29159214 GTTTGTGGTCTCGCTGGCCTAGG + Intronic
1124573297 15:30884941-30884963 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1125480132 15:40074101-40074123 GTTTGTGGTCTCGCTGGCTTAGG + Intergenic
1125565598 15:40676247-40676269 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1125885405 15:43225971-43225993 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1125914379 15:43473001-43473023 GTTCGTGGTCTCGCTGGTTCAGG + Intronic
1126089145 15:45035859-45035881 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1126128233 15:45315019-45315041 GTTCCCGGTTTCGCTGGCTCAGG - Intergenic
1126165387 15:45650409-45650431 GTTCGTGGTCTCCCTGGCTCAGG + Intronic
1126639823 15:50812949-50812971 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1127403160 15:58612567-58612589 GCACCTGGTCTCACAGACTTTGG + Intronic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1127984944 15:64061943-64061965 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1128111033 15:65076420-65076442 GTTCATGGTCTCGCTGGCTCAGG - Intronic
1128140902 15:65300362-65300384 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
1128497278 15:68205728-68205750 GCACCGGGGCTCGCAGGCTTGGG + Intronic
1128598411 15:68974920-68974942 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1128813125 15:70586342-70586364 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1129208819 15:74053715-74053737 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1129280194 15:74479234-74479256 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1129373849 15:75115277-75115299 GTTCCTGGTCTCACTGGCTCAGG + Intronic
1129586790 15:76875748-76875770 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1129777341 15:78245422-78245444 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1129987040 15:79927058-79927080 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1129997313 15:80017627-80017649 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1130133039 15:81159783-81159805 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1130185464 15:81677270-81677292 GCTTCTGTCCTCGTTGGCTTGGG - Intergenic
1131212758 15:90511567-90511589 GTTCGTGGTCTCGCTGGCTTAGG - Intergenic
1131507929 15:93032749-93032771 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1131845942 15:96491117-96491139 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1131854169 15:96575124-96575146 GATCCTGGTTTCCCTGGATTTGG - Intergenic
1131956666 15:97743220-97743242 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1132097860 15:99001075-99001097 GTTCATGGTCTTGCTGGCTCAGG - Intronic
1132933079 16:2468548-2468570 GCTCCTGGGCTGTCTGCCTTCGG + Intergenic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1133362498 16:5185651-5185673 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1135281024 16:21153658-21153680 GTTTCTGGTCTCGCTGGCGCAGG - Intronic
1135299231 16:21311997-21312019 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1135942544 16:26835457-26835479 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
1136067151 16:27766946-27766968 GCTCCAGGTCTGGCTGGCCAAGG - Intronic
1138168994 16:54830932-54830954 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1138657330 16:58499033-58499055 GCTCCTGCTCTCCCAGCCTTGGG + Intronic
1138688932 16:58749881-58749903 GTTCATGGTCTCGCTGACTCAGG - Intergenic
1138693461 16:58790223-58790245 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1139442459 16:66975213-66975235 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1139600426 16:67983177-67983199 GTTCATGGCCTCGCTGGCTTCGG - Intergenic
1141465573 16:84203824-84203846 GTTCGTGGTCTCGCTGGCTTAGG + Intergenic
1141748149 16:85939952-85939974 TCACCTGGCATCGCTGGCTTTGG - Intergenic
1142059660 16:88021139-88021161 TCCCCTGGGCCCGCTGGCTTCGG + Intronic
1142139659 16:88467228-88467250 GCTCCTGGTCTGGGTGACTGTGG - Intronic
1142142717 16:88479718-88479740 CCTCCTGGTCTTGCTGGCCCTGG - Intronic
1143106158 17:4531525-4531547 ACTTCCGGTCTCGCTGGGTTTGG + Intronic
1143127837 17:4655794-4655816 GTTGGTGGTCTCGCTGGCTCAGG + Intergenic
1143283556 17:5772560-5772582 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1143460383 17:7100084-7100106 GTTCATGGTCTCACTGGCTCAGG + Intergenic
1143552896 17:7642102-7642124 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1144467299 17:15506689-15506711 GTTCGTGGTCTCGCTGACTCAGG - Intronic
1144723384 17:17487544-17487566 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1146740312 17:35278330-35278352 GTTCATGGTCTCTCTGGCTCAGG + Intergenic
1147373871 17:40012584-40012606 GTTCGTGGTCTCGCTGGCTGAGG - Intergenic
1147997717 17:44370036-44370058 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1148017033 17:44529046-44529068 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1148366019 17:47056574-47056596 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1149099103 17:52883302-52883324 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1150788433 17:68180945-68180967 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
1150804470 17:68308367-68308389 GTTCATGGTCTCACTGGCTCAGG + Intronic
1151672857 17:75581574-75581596 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1151782497 17:76256779-76256801 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1152381575 17:79945018-79945040 GCACCTGGTCTCGCTGGGCGAGG - Exonic
1152618886 17:81351321-81351343 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1152754866 17:82082991-82083013 GCTGGTGGTCTGGGTGGCTTCGG - Exonic
1153050805 18:901645-901667 GCTCCTGGTCTCTCTAGCCTGGG + Intergenic
1153070522 18:1099146-1099168 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1153643877 18:7177826-7177848 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1153832311 18:8934722-8934744 GTTCGTGGTCTCTCTGGCTCAGG + Intergenic
1154057072 18:11022923-11022945 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1154217109 18:12423385-12423407 ACTACTGGTCTCCCTGGCTCAGG - Intronic
1154293975 18:13134103-13134125 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1154942804 18:21131717-21131739 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1155003475 18:21707574-21707596 GTTCGTGGTCTCCCTGGCTCAGG - Intronic
1155207869 18:23576683-23576705 GTTCGTGATCTCGCTGGCTCAGG + Intronic
1155271779 18:24148681-24148703 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1155611552 18:27673102-27673124 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1155773028 18:29724551-29724573 GTTCGTGGTTTCGCTGGCTCAGG - Intergenic
1155852431 18:30789537-30789559 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1155856218 18:30838486-30838508 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1156079659 18:33317336-33317358 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1156486877 18:37471992-37472014 GCTCCTGCTCTCCCTGGTTAGGG + Intronic
1156610351 18:38717668-38717690 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1156863825 18:41866951-41866973 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1156943332 18:42796303-42796325 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1157086134 18:44581866-44581888 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
1157519235 18:48334067-48334089 CCTCCTTGCCTCCCTGGCTTGGG - Intronic
1157661813 18:49452202-49452224 GTTCGTGCTCTCGCTGGCTTAGG + Intronic
1157856735 18:51110962-51110984 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1157858237 18:51120280-51120302 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1158352089 18:56573373-56573395 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1158451949 18:57574612-57574634 GCTCCTGGCCTGGCTCACTTTGG - Intronic
1158536824 18:58315811-58315833 GCTCCTGGTCTCCCGGGGTGTGG + Intronic
1158554066 18:58460666-58460688 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
1158697095 18:59713309-59713331 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1158705599 18:59789782-59789804 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1159230975 18:65606321-65606343 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1159472757 18:68879019-68879041 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1159655803 18:71029374-71029396 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1159655943 18:71030485-71030507 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1159670004 18:71211701-71211723 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1160176434 18:76599178-76599200 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1160198723 18:76778454-76778476 GCTCGTGGTCTCGCTAGCTCAGG - Intergenic
1160198734 18:76778554-76778576 GTTCGTGGTTTCGCTGGCTCAGG - Intergenic
1160199920 18:76787849-76787871 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1160848043 19:1175178-1175200 GCTCCTCCTCTCGGTGGCTGTGG + Intergenic
1162232929 19:9282620-9282642 GTCCATGGTCTCGCTGGCTCAGG + Intergenic
1162237903 19:9322671-9322693 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1162261930 19:9540884-9540906 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1162415391 19:10533338-10533360 GTGCCTGGTCTTGCTGCCTTTGG - Intergenic
1162416147 19:10539006-10539028 GTTCGTGGTCTCGCTGGCTCGGG + Intergenic
1162632525 19:11940420-11940442 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1162814552 19:13185879-13185901 GTTCGTGATCTCGCTGGCTCAGG + Intergenic
1162987257 19:14278785-14278807 GCTGGTGGTCCCGCTGGCTTCGG - Intergenic
1163181545 19:15607776-15607798 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1163218968 19:15900446-15900468 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1164143877 19:22498317-22498339 TCTCGTGGTCTCGCTGGCTCAGG + Intronic
1164270346 19:23667110-23667132 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1164845636 19:31430328-31430350 GCTGCTGGTCACTCTGGCTCAGG - Intergenic
1164975975 19:32572942-32572964 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1165036538 19:33037688-33037710 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
1165415381 19:35690469-35690491 GTTCCTGGTCTCGCCGGCTCAGG + Intergenic
1165642608 19:37403014-37403036 TCTCCTGCTCTGGCTGGCTTGGG + Intergenic
1166649587 19:44562568-44562590 GTTCCTGGTCTCGCTGGCTCAGG + Intergenic
1167625624 19:50586534-50586556 GCTGCAGGTCTGGCTGGCTCAGG - Intergenic
1168058950 19:53879745-53879767 TCTCTAGATCTCGCTGGCTTCGG - Intronic
1168538891 19:57193985-57194007 GCTCCTGGTGTCTCTGGGTAAGG + Exonic
1168545149 19:57244033-57244055 GCTCCTGGTATCTCTGGGTAAGG + Exonic
925088530 2:1134002-1134024 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
925098817 2:1228890-1228912 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
925537646 2:4934600-4934622 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
926616457 2:15001775-15001797 GCTTGTGGTCTCACTGGCTCAGG + Intergenic
926685693 2:15696031-15696053 GTTCGTGGTCTCACTGGCTCAGG + Intronic
926850808 2:17194583-17194605 GTTCTTGGTCTCCCTGGCTCAGG - Intergenic
927942048 2:27110837-27110859 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
928106519 2:28473828-28473850 GTTCATGGTCTCGCTGACTCAGG - Intronic
928493226 2:31804710-31804732 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
928617785 2:33056673-33056695 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
928640012 2:33288432-33288454 GCTCATTGTCTCGTTGCCTTGGG - Intronic
928753351 2:34495330-34495352 GTTCGTAGTCTCGCTGGCTTAGG - Intergenic
928880727 2:36093276-36093298 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
928937052 2:36689294-36689316 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
929070205 2:38021505-38021527 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
929168640 2:38908683-38908705 GCTCCTGTTCTCACTGGCTCTGG + Intronic
929202005 2:39245347-39245369 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
929618676 2:43333151-43333173 GCACCTTGTCCCACTGGCTTGGG + Intronic
930039377 2:47108410-47108432 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
930198310 2:48530165-48530187 CCTCCTGGTGTGGCTGGCTGCGG + Exonic
930468063 2:51779579-51779601 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
930485668 2:52007842-52007864 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
930845207 2:55895959-55895981 GCACCTTGTCTGGCTGGCTCAGG + Intronic
930966549 2:57335608-57335630 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
931218548 2:60268135-60268157 GCTCCTGATTTCACTGGATTTGG - Intergenic
931708851 2:64970067-64970089 GTTCGTAGTCTCGCTGGCTCAGG - Intergenic
932178431 2:69623155-69623177 GTTCGTGGTCTCGCTAGCTCAGG - Intronic
932240111 2:70149619-70149641 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
932359342 2:71091673-71091695 GTTCTTGGTCTTGCTGGCTCAGG + Intergenic
932486611 2:72087746-72087768 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
932486626 2:72087847-72087869 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
932521972 2:72423219-72423241 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
932902563 2:75716076-75716098 GCTACTGAACACGCTGGCTTAGG + Intergenic
932983360 2:76697653-76697675 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
933060682 2:77734021-77734043 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
933441922 2:82325441-82325463 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
933487087 2:82937649-82937671 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
933505918 2:83177184-83177206 GTTCCTGGTCTCCTTGACTTCGG + Intergenic
933506473 2:83182058-83182080 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
933548906 2:83749335-83749357 GTTCATGGTCTCACTGGCTCAGG - Intergenic
933711984 2:85333525-85333547 GTTCATGGTCTCGCCGGCTCAGG + Intergenic
934085285 2:88504230-88504252 GTTCTTGGTCTCGCTGGCTCAGG - Intergenic
934898657 2:98140075-98140097 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
935866589 2:107393341-107393363 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
935896700 2:107746774-107746796 GTTCCTGCTCTCGCTGGCTCAGG + Intergenic
936172537 2:110189347-110189369 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
936347054 2:111682982-111683004 GCTCATGGTCTTGCTGGCTCAGG - Intergenic
936347065 2:111683083-111683105 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
936433919 2:112486698-112486720 GCTCCTTCTCTCACTAGCTTGGG + Intronic
936581390 2:113704010-113704032 GTTCGTGGTCTCGCCGGCTCAGG + Intergenic
937181294 2:119998034-119998056 GTTCATGGTCTCACTGGCTCAGG - Intergenic
937209432 2:120258958-120258980 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
937209446 2:120259059-120259081 GCTCGTGGTCTTGCTGGGCTCGG + Intronic
937597160 2:123686199-123686221 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
937711693 2:124986742-124986764 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
937746780 2:125423600-125423622 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
938125911 2:128671352-128671374 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
938401185 2:130992519-130992541 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
938725884 2:134108722-134108744 GTTCGTGGTCTCGCTGGCTTCGG + Intergenic
939003291 2:136759506-136759528 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
939003915 2:136765103-136765125 TCTCCTGGGCTCAGTGGCTTGGG + Intergenic
939229888 2:139411098-139411120 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
939229906 2:139411195-139411217 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
939281909 2:140074753-140074775 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
939465292 2:142547104-142547126 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
939509477 2:143089026-143089048 GTTCCTGGTCTCACTGGCTCAGG + Intergenic
939738609 2:145880233-145880255 ATTCGTGGTCTCGCTGGCTCAGG + Intergenic
939899066 2:147827979-147828001 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
939912126 2:147995707-147995729 GTTCGTGGTCTCGCTAACTTCGG - Intronic
939972396 2:148677735-148677757 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
940215267 2:151297206-151297228 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
940666533 2:156617318-156617340 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
940784446 2:157967261-157967283 GTTCGTGGTCTCGCTAGCTCAGG + Intronic
941240247 2:163027310-163027332 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
941397776 2:164994090-164994112 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
941614727 2:167706483-167706505 GCTCTTGGTCTCTCTGCTTTTGG - Intergenic
941705692 2:168656489-168656511 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
941711962 2:168724156-168724178 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
941711974 2:168724257-168724279 GCTCGTGGTCTCGCTGGCTCAGG + Intronic
941820953 2:169842686-169842708 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
942082409 2:172413111-172413133 GCTCCTGTTCTCTGTGGCCTTGG + Intergenic
942299414 2:174547555-174547577 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
942317434 2:174708723-174708745 GTTCGTGGTCTCGGTGGCTCAGG + Intergenic
942393111 2:175517056-175517078 GCTCCTGGTGACTCTGGCCTGGG + Intergenic
942540353 2:177008930-177008952 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
942867424 2:180692252-180692274 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
943105997 2:183545953-183545975 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
943680183 2:190760236-190760258 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
943790206 2:191922798-191922820 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
943835309 2:192509038-192509060 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
943905941 2:193501620-193501642 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
944055338 2:195516799-195516821 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
944228597 2:197371593-197371615 GTTCCCGGTCTCGCTGGCTCAGG - Intergenic
944252318 2:197590694-197590716 GTTCGTGGTCTCGCTGGTTCAGG + Intronic
944729801 2:202504445-202504467 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
944857762 2:203784790-203784812 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
945069781 2:205978252-205978274 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
945872682 2:215245117-215245139 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
946613128 2:221480459-221480481 GCTGCTGGTCTCTCTGAATTAGG - Intronic
946923387 2:224602867-224602889 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
946982000 2:225228699-225228721 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
947412146 2:229851770-229851792 GTTCATGGTCTCGCTGGCTCAGG - Intronic
947931896 2:233971698-233971720 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
948254080 2:236553235-236553257 GCTCCTGGGGCCTCTGGCTTCGG - Intergenic
948703665 2:239776521-239776543 GCGCCTGGTCCCACTGGCCTCGG - Intronic
948912555 2:241011753-241011775 GCTCCTGGGCCCTCTGGCCTGGG + Intronic
1169645198 20:7802939-7802961 GTTCGTGGTCTAGCTGGCTCAGG + Intergenic
1169814279 20:9640715-9640737 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1169849351 20:10032753-10032775 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1170230738 20:14044167-14044189 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1170246627 20:14227531-14227553 GTGCATGGTCTCGCTGGCTCAGG - Intronic
1170649663 20:18227850-18227872 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1172431689 20:34898070-34898092 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1172603673 20:36200530-36200552 GCTCCAGATGTCTCTGGCTTAGG - Intronic
1173195359 20:40909617-40909639 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1173195847 20:40912216-40912238 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1173203222 20:40969341-40969363 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1173704654 20:45100958-45100980 GCTCCCAGCCTCGGTGGCTTTGG - Exonic
1173778933 20:45737069-45737091 GTTTGTGGTCTCGCTGGCTTAGG - Intergenic
1173831687 20:46093066-46093088 GTTCGTGGGCTCGCTGGCTCAGG - Intergenic
1174448963 20:50608498-50608520 GGGCCTGGGCTCGCTGGCTGTGG - Exonic
1175254323 20:57629931-57629953 GATCGTAGTCTCGCTGGCTCAGG - Intergenic
1175335471 20:58193205-58193227 GCTCCTGGTCTGGCAGGGTCAGG - Intergenic
1176332151 21:5558987-5559009 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1176395606 21:6261964-6261986 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1176441551 21:6727140-6727162 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1176465813 21:7054209-7054231 GCTCGTGGTCTCGCTGGCTCAGG + Intronic
1176489374 21:7435987-7436009 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1176663596 21:9663515-9663537 GTTCGTGGTCTGGCTGGCTCAGG + Intergenic
1176966444 21:15217742-15217764 GTTCGTGGCCTCGCTGGCTCAGG + Intergenic
1177182238 21:17756877-17756899 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1177318875 21:19494641-19494663 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1177497101 21:21903617-21903639 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1177565688 21:22818296-22818318 GTTCATGGTCTCGATGGCTCAGG + Intergenic
1177637792 21:23808142-23808164 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1178082090 21:29076539-29076561 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1178327140 21:31655164-31655186 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1178585523 21:33867920-33867942 GCTCGTGGTCTCGCTAGCTCAGG + Intronic
1178983198 21:37282473-37282495 GTTCGTAGTCTCGCTGGCTCAGG + Intergenic
1179791780 21:43759968-43759990 GCTCCAGGCTTCCCTGGCTTAGG - Exonic
1180844738 22:18974938-18974960 CCTCCTGGTCTGGCTGCCGTGGG - Intergenic
1181178822 22:21053278-21053300 GCTCCTGGTCTCTGAGGCTGTGG + Intronic
1181450371 22:23016248-23016270 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1181627791 22:24133280-24133302 GCTCCCTGACTCGCTGGCTGTGG - Intronic
1182222892 22:28772831-28772853 CCTCCTCGTCTCGCCGGCTATGG + Exonic
1182550176 22:31096728-31096750 GCTCCTTGTCCCGCTGGTCTGGG - Exonic
1183370588 22:37429500-37429522 CCTCCAGGTCTGGCTGGATTTGG + Intergenic
1183421961 22:37717117-37717139 GTTCGCGGTCTCGCTGGCTCAGG + Intronic
1183685385 22:39358619-39358641 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1183996434 22:41636723-41636745 GGTCCTGGCCCGGCTGGCTTTGG - Exonic
1184108729 22:42383257-42383279 TCTCCTGGTCTTGCTGGCTTCGG + Exonic
1184906097 22:47487683-47487705 GTTCGTGGTCTAGCTGGCTCAGG + Intergenic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
949259170 3:2084912-2084934 GTTCGTGCTCTCGCTGGCTCAGG - Intergenic
950256519 3:11511025-11511047 GTTCGTGGTCTCGCTGGCTCGGG + Intronic
950400815 3:12768104-12768126 GTTCACGGTCTCGCTGGCTCAGG + Intronic
950418692 3:12883810-12883832 GTTCCTGGTCTCACTGGCTGAGG - Intergenic
950470321 3:13180801-13180823 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
950513201 3:13446366-13446388 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
950600183 3:14028471-14028493 GTTCGTGGTCTCGCTGGCTTAGG + Intronic
950632821 3:14294439-14294461 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
950632835 3:14294540-14294562 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
950929572 3:16774912-16774934 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
951146470 3:19233882-19233904 GTTCGTGGTCTCACTGGCTCAGG + Intronic
951332775 3:21386273-21386295 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
951734942 3:25852849-25852871 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
951950902 3:28199579-28199601 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
952057916 3:29472603-29472625 GTTCGTGGTCTCACTGGCTCAGG + Intronic
952275430 3:31871351-31871373 GTTCATAGTCTCGCTGGCTCAGG - Intronic
952398414 3:32940991-32941013 GGTCGGGGTCTCGCTGGCTCAGG - Intergenic
952452679 3:33446853-33446875 GTTCGTGGTCTTGCTGGCTTAGG - Intergenic
952713473 3:36454378-36454400 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
952795410 3:37234093-37234115 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
953089994 3:39714508-39714530 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
953423184 3:42770843-42770865 GTTCATGGTCTCGCTGGCTCAGG - Intronic
953522294 3:43655340-43655362 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
953673919 3:44985472-44985494 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
953714788 3:45307905-45307927 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
953757192 3:45656886-45656908 CCTCCAGGGCTGGCTGGCTTGGG + Intronic
954041187 3:47888521-47888543 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
954198906 3:49012729-49012751 GCTCCTGGTCCCGAGGGCTTCGG + Exonic
954226036 3:49181949-49181971 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
954757988 3:52852503-52852525 GGTCCTGCTCCCTCTGGCTTGGG - Intronic
954983265 3:54765428-54765450 GCTCATGGTCTCCCTAGCATCGG - Intronic
955183503 3:56692851-56692873 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
955186581 3:56720046-56720068 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
955210459 3:56935659-56935681 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
955266267 3:57448265-57448287 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
956183793 3:66543921-66543943 GTTCGTGGTCTCGCTCGCTCAGG + Intergenic
956195902 3:66652598-66652620 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
956392016 3:68784426-68784448 GTTCACGGTCTCGCTGGCTCAGG + Intronic
956481646 3:69678757-69678779 GTTCGTGGTCTCGTTGGCTCAGG - Intergenic
956632769 3:71332308-71332330 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
957009003 3:74984190-74984212 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
957074243 3:75588841-75588863 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
957277633 3:78109465-78109487 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
957362233 3:79174358-79174380 GTTCGTGGTTTCGCTGGCTCAGG - Intronic
957371632 3:79301184-79301206 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
957419493 3:79950640-79950662 ATTCGTGGTCTCGCTGGCTCAGG + Intergenic
957446276 3:80315528-80315550 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
957556141 3:81766647-81766669 GTTCGTGGTCTGGCTGGCTCAGG + Intergenic
957559998 3:81811293-81811315 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
957631095 3:82716404-82716426 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
957829875 3:85504177-85504199 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
957885650 3:86283444-86283466 GTTCGTGGTCTCGGTGGCTCAGG - Intergenic
957921983 3:86758669-86758691 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
957995274 3:87680292-87680314 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
958022800 3:88016713-88016735 GTTCCTGGTCTCACTGGCTCAGG - Intergenic
958420011 3:93918505-93918527 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
958810591 3:98857102-98857124 GTTCGTGGTCTCACTGGCTCAGG + Intronic
959422916 3:106149865-106149887 GTTCGTGGACTCGCTGGCTCAGG - Intergenic
960149604 3:114237291-114237313 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
960199254 3:114812008-114812030 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
960227390 3:115184333-115184355 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
960282215 3:115792093-115792115 GCTCGTGGTCTCGCTGGCTTCGG - Intergenic
960282230 3:115792194-115792216 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
960487454 3:118270728-118270750 GTTCATGGTCTCGCTGGCTCCGG - Intergenic
960868416 3:122226245-122226267 GTTCGTGGTCTTGCTGGCTCAGG + Intronic
960874671 3:122284765-122284787 GCTGCTGCTCTTGCTGGGTTAGG - Exonic
961268940 3:125672778-125672800 GTTGCTGGTCTCACTGGCTCAGG - Intergenic
961460630 3:127047869-127047891 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
961688970 3:128654483-128654505 GTTCGTGGTCTCGCTGGCTCGGG - Intronic
961874543 3:130011680-130011702 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
962108353 3:132417000-132417022 TCTCCTGGTTTGGCTGGATTGGG - Intergenic
962383606 3:134915656-134915678 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
962398600 3:135038695-135038717 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
962600338 3:136986871-136986893 GTTCCTAGTCTCGCTGGCTCAGG + Intronic
962671531 3:137713834-137713856 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
962758424 3:138485922-138485944 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
962998301 3:140652619-140652641 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
963397397 3:144751039-144751061 GTTCGTGGTCCCGCTGGCTCAGG - Intergenic
963440579 3:145334341-145334363 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
963508975 3:146224530-146224552 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
963533410 3:146498343-146498365 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
963554802 3:146773356-146773378 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
963673360 3:148279922-148279944 GTTCGTGGTCCCGCTGGCTCAGG + Intergenic
963742762 3:149097005-149097027 GTTCATGGTCTCACTGGCTCAGG + Intergenic
963760734 3:149284916-149284938 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
964032510 3:152153621-152153643 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
964117812 3:153155056-153155078 CTTCGTGGTCTCGCTGGCTCAGG + Intergenic
964139054 3:153377506-153377528 GTTCGTGGTCTCTCTGGCTCAGG + Intergenic
964375198 3:156042377-156042399 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
964381258 3:156100487-156100509 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
964444165 3:156741600-156741622 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
964451964 3:156821803-156821825 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
964802747 3:160573377-160573399 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
964974291 3:162600396-162600418 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
964977916 3:162641155-162641177 GTTCACGGTCTCGCTGGCTCAGG - Intergenic
964982992 3:162709689-162709711 GATTGTGGTCTCGCTGGCTCAGG + Intergenic
965003669 3:162988307-162988329 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
965040453 3:163500108-163500130 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
965078171 3:164004054-164004076 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
965109264 3:164401264-164401286 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
965200200 3:165648708-165648730 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
965210277 3:165777745-165777767 GCTGTTGGTCTCGCTGTCTCTGG - Intronic
965220067 3:165917883-165917905 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
965220730 3:165923503-165923525 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
965837525 3:172867812-172867834 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
965943306 3:174211071-174211093 GTTCGTGGTCTCGCTCGCTCAGG + Intronic
966096627 3:176212702-176212724 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
966245897 3:177807978-177808000 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
966548831 3:181182361-181182383 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
966725158 3:183101934-183101956 GTTCGTGGTCTCACTGGCTCAGG - Intronic
966725274 3:183103134-183103156 GTTCCTGGTCTCACTAGCTCAGG + Intronic
967448637 3:189596989-189597011 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
967718508 3:192790000-192790022 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
968360876 3:198145775-198145797 GTTCATGGTCTTGCTGGCATTGG - Intergenic
968469845 4:774789-774811 GTTCATGGTCTCGATGGCTCAGG - Intergenic
968469857 4:774890-774912 GTTCGTGGTCTCGATGGCTCAGG - Intergenic
968716321 4:2162343-2162365 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
968804294 4:2762506-2762528 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
968809693 4:2794297-2794319 GCTCCTGCCCTCACTGGCTCAGG + Intronic
968965428 4:3766870-3766892 CTTCCTGGTGTCGCTGGCCTCGG + Exonic
969017858 4:4116441-4116463 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
969362492 4:6673575-6673597 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
969654782 4:8490395-8490417 ATTCGTGGTCTCGCTGGCTCAGG + Intronic
969795342 4:9523734-9523756 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
969857792 4:10014151-10014173 GTTCCTGGTCTCCCTGGTTCTGG + Intronic
970051420 4:11918869-11918891 GTTTGTGGTCTCGCTGGCTGAGG - Intergenic
970182724 4:13416312-13416334 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
970272261 4:14359649-14359671 GTTCGTGGTCTCGCTGGATCAGG - Intergenic
970391389 4:15616109-15616131 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
970649162 4:18158560-18158582 GTTCATGGTCTCACTGGCTCAGG + Intergenic
970803674 4:20004880-20004902 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
970817721 4:20178183-20178205 GTTCGTGGTCTCGCTGGCTTAGG + Intergenic
971280384 4:25238584-25238606 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
971376943 4:26063261-26063283 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
971552879 4:27977661-27977683 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
971563725 4:28113862-28113884 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
971709606 4:30093750-30093772 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
972022640 4:34335086-34335108 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
972392707 4:38627929-38627951 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
972505641 4:39717816-39717838 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
972900307 4:43673661-43673683 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
973037249 4:45421083-45421105 GTTCAGGGTCTCGCTGGCTCAGG - Intergenic
973039792 4:45456358-45456380 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
973144110 4:46804063-46804085 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
973146487 4:46832247-46832269 GTTCGTGGTCTCACTGGCTCAGG - Intronic
973190165 4:47377431-47377453 GTTCGTGGTCTCGGTGGCTCAGG + Intronic
973308225 4:48676316-48676338 GTTCGTGGTCTCACTGGCTCAGG - Intronic
973587595 4:52408971-52408993 GTTCGTGGTCTCGCTGACTCAGG + Intergenic
973764923 4:54154288-54154310 GTTCATGGTCTCGCTGGCTCAGG + Intronic
973888400 4:55346139-55346161 GGTCCTGGTCGCGCTGGCGCTGG - Exonic
974128789 4:57728931-57728953 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
974147579 4:57966498-57966520 GTTCATGGTCTCACTGGCTCAGG - Intergenic
974174160 4:58304591-58304613 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
974484621 4:62491193-62491215 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
974590429 4:63942225-63942247 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
974641588 4:64639760-64639782 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
974781552 4:66560566-66560588 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
974792566 4:66711373-66711395 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
974804539 4:66861141-66861163 GTTCATGGTCTGGCTGGCTCAGG - Intergenic
974827907 4:67152810-67152832 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
974892144 4:67895889-67895911 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
974992703 4:69114448-69114470 GTTCTTGGTCTTGCTGGCTCAGG + Intronic
975055561 4:69924966-69924988 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
975298963 4:72766881-72766903 GTTCGTGGTCTGGCTGGCTGAGG - Intergenic
975308703 4:72878189-72878211 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
975439804 4:74398493-74398515 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
975595039 4:76042682-76042704 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
975596203 4:76049942-76049964 GTTCGTGGTCTCACTGGCTCAGG + Intronic
975596217 4:76050043-76050065 GCTTATGGTCTCACTGGCTCAGG + Intronic
975756049 4:77571976-77571998 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
976406560 4:84665942-84665964 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
976520446 4:86020661-86020683 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
976565672 4:86548269-86548291 GTTCGCGGTCTCGCTGGCTCAGG - Intronic
976646710 4:87395260-87395282 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
976690449 4:87862914-87862936 GTTCGTGGTCTCGCTGGCGCAGG + Intergenic
976736123 4:88312183-88312205 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
976846239 4:89491192-89491214 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
976980118 4:91217092-91217114 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
977606751 4:98992646-98992668 GTTCCTGGTCTCGCTGGCTCAGG + Intergenic
977717157 4:100195548-100195570 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
977717171 4:100195676-100195698 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
977717184 4:100195807-100195829 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
977750793 4:100607972-100607994 GTTCATGGTCTCGCTGGCTCAGG + Intronic
977906641 4:102484484-102484506 GTTTGTGGTCTCGCTGGCTTAGG - Intergenic
978254729 4:106680748-106680770 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
978463461 4:108983676-108983698 GTTCATGGTCTCGCTGGCTCAGG + Intronic
978466412 4:109013730-109013752 GTTCGTGGTCTCGCTGGCTTCGG - Intronic
978905858 4:114004824-114004846 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
978997881 4:115178770-115178792 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
978997894 4:115178871-115178893 GCTCGTGCTCTCGCTGGCTCAGG + Intergenic
979201655 4:117986067-117986089 GCTCCTCTTCTCACTGTCTTTGG + Intergenic
979290653 4:118976224-118976246 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
979308499 4:119174979-119175001 GTTCATGGTCTCACTGGCTCAGG - Intronic
979756016 4:124339985-124340007 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
979822700 4:125192995-125193017 GTTCGTGATCTCGCTGGCTCAGG - Intergenic
979899550 4:126200620-126200642 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
979949363 4:126873596-126873618 GTTCGTGGTCTCGCTGGGTCAGG + Intergenic
979991665 4:127381455-127381477 GTTCGTGGTCTCGCTGGCTTAGG - Intergenic
980228172 4:130014176-130014198 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
980230097 4:130037834-130037856 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
980470035 4:133239469-133239491 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
980628762 4:135407788-135407810 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
980704583 4:136476790-136476812 CCTCCCTGTCTCTCTGGCTTGGG - Intergenic
980799925 4:137734811-137734833 GTTCGTGGTCTCGTTGGCTCAGG - Intergenic
980815728 4:137943265-137943287 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
980827180 4:138087913-138087935 GTTCATGGGCTCGCTGGCTCAGG + Intergenic
981146565 4:141332366-141332388 GTTCGTGGCCTCGCTGGCTCAGG + Intergenic
981176413 4:141688991-141689013 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
981275973 4:142898574-142898596 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
981726259 4:147850562-147850584 GTTCGTGGTCTTGCTGACTTAGG - Intronic
982408383 4:155045352-155045374 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
982647826 4:158045305-158045327 GTTCGTGATCTCGCTGGCTCAGG - Intergenic
982692931 4:158568121-158568143 GTTCGTGGTCTCACTGGCTCAGG - Intronic
982728360 4:158928893-158928915 GATCGTGGTCTCGCTGGCTCAGG - Intronic
982814416 4:159868318-159868340 GTTCGCGGTCTCGCTGGCTCAGG + Intergenic
982863546 4:160482804-160482826 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
982868654 4:160549534-160549556 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
982921437 4:161278308-161278330 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
983026273 4:162740735-162740757 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
983060513 4:163154045-163154067 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
983230493 4:165125135-165125157 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
983230502 4:165125226-165125248 GTTCGTGGTCTCACTGGCTCAGG + Intronic
983552866 4:169034884-169034906 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
983753008 4:171299358-171299380 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
984192659 4:176624345-176624367 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
984192672 4:176624446-176624468 GCTCGTGGTCTCGCTGGCTTCGG + Intergenic
984238654 4:177192482-177192504 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
984241684 4:177226900-177226922 GTTCTTGGTCTCGCTGGCTCAGG + Intergenic
984265828 4:177496665-177496687 GTTCGTGGTCTCGCTGGTTCGGG - Intergenic
984275568 4:177606248-177606270 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
984662428 4:182387732-182387754 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
984770724 4:183434237-183434259 GCTCGTGGTCTAGCTGGCTCAGG - Intergenic
984775948 4:183481974-183481996 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
984901890 4:184592799-184592821 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
985087237 4:186325473-186325495 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
985194944 4:187419687-187419709 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
985203400 4:187506599-187506621 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
985366543 4:189237239-189237261 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
985411711 4:189692418-189692440 GTTCGTGGTCTGGCTGGCTCAGG - Intergenic
986152218 5:5139141-5139163 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
986698162 5:10376351-10376373 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
986993454 5:13579583-13579605 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
987146089 5:14993131-14993153 GTTCGTGGTCTCGCTGGCTCGGG + Intergenic
987347278 5:16990257-16990279 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
987352139 5:17031749-17031771 GTTCGTGATCTCGCTGGCTTAGG + Intergenic
987543979 5:19288713-19288735 GTTCGTGGTCTCGCTAGCTCAGG - Intergenic
987543990 5:19288814-19288836 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
987877107 5:23692160-23692182 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
987896445 5:23952339-23952361 GTTCGTGGTCTCGCTAGCTCAGG - Intronic
988073658 5:26325431-26325453 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
988086807 5:26484446-26484468 GTTCATGGTCTCGCTGCCTCAGG + Intergenic
988132316 5:27120933-27120955 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
988154877 5:27438617-27438639 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
988177440 5:27744592-27744614 GCTTGTGGTCTTACTGGCTTAGG - Intergenic
988201605 5:28076787-28076809 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
988369407 5:30346617-30346639 GTTCGTGGTCTCGTTGGCTCAGG - Intergenic
988488966 5:31691169-31691191 GTTCGTGGTGTCGCTGGCTCAGG + Intronic
988684578 5:33514677-33514699 GTTCGTGGTCTCGCTGGCTCGGG + Intergenic
989003370 5:36783663-36783685 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
989003384 5:36783795-36783817 GTTCGTGCTCTCGCTGGCTCAGG - Intergenic
989346961 5:40439750-40439772 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
989951160 5:50298848-50298870 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
989957011 5:50370582-50370604 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
989958068 5:50377815-50377837 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
989965987 5:50466208-50466230 GTTCATGGTCTTGCTGGCTCAGG - Intergenic
990243404 5:53838107-53838129 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
990345445 5:54866307-54866329 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
990461663 5:56036422-56036444 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
990490248 5:56296577-56296599 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
990869623 5:60416557-60416579 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
990880373 5:60531357-60531379 GTTCACGGTCTCGCTGGCTCAGG - Intergenic
991330083 5:65484865-65484887 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
991427258 5:66504379-66504401 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
992203009 5:74402476-74402498 GCTCCTGGCCAGGCTGGCTATGG - Intergenic
992296905 5:75334837-75334859 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
992947263 5:81822856-81822878 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
992947592 5:81824637-81824659 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
993328395 5:86568696-86568718 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
993529031 5:89002899-89002921 GTTCATGTTCTCGCTGGCTCAGG + Intergenic
993770450 5:91918314-91918336 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
993822204 5:92632415-92632437 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
994096532 5:95852476-95852498 GTTCGTGGTCTTGCTGGCTCAGG - Exonic
994230109 5:97302122-97302144 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
994251352 5:97541152-97541174 GGTCGTGGTCTCGCTGGCTCAGG + Intergenic
994254629 5:97579279-97579301 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
994507258 5:100657710-100657732 GTTCACGGTCTCGCTGGCTCAGG - Intergenic
994509652 5:100687991-100688013 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
994605415 5:101961492-101961514 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
994647601 5:102490661-102490683 GTTCGTGGTCTCCCTGGCTCAGG + Intronic
994669868 5:102753040-102753062 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
994701540 5:103141315-103141337 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
994769627 5:103965613-103965635 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
994841554 5:104930068-104930090 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
994928965 5:106155329-106155351 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
994935427 5:106247218-106247240 GTTCGTGGTCTGGCTGGCTCAGG - Intergenic
995206514 5:109487124-109487146 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
995388176 5:111611434-111611456 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
995512401 5:112922086-112922108 GCTCCTGTTCACGCCGGTTTTGG + Exonic
995568853 5:113458378-113458400 GTTCGTGGTCCCGCTGGCTCAGG - Intronic
995596303 5:113752444-113752466 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
995656670 5:114433756-114433778 GTTCCTGGTCTCGCTGGCTCAGG - Intronic
995679699 5:114703378-114703400 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
995920610 5:117306177-117306199 GTTCATGGTCTTGCTGGCTCAGG - Intergenic
995975976 5:118034887-118034909 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
995988319 5:118207533-118207555 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
996107220 5:119518298-119518320 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
996234395 5:121108363-121108385 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
996423224 5:123285458-123285480 GCTCCGGGTCTAACTGGCCTCGG - Intergenic
996435868 5:123431631-123431653 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
996530552 5:124522604-124522626 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
999195422 5:149778439-149778461 GCTCTTGGGCTCCCTGGGTTGGG + Intronic
999406342 5:151310269-151310291 GCCCGTGGTCTCGCTGGCTCAGG - Intergenic
999855106 5:155585960-155585982 GTTCGTAGTCTCGCTGGCTCAGG + Intergenic
1000212509 5:159120255-159120277 GTTCCTGGTCTCACTAGCTCAGG - Intergenic
1000329023 5:160193195-160193217 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1000432214 5:161165409-161165431 GTTGGTGGTCTCGCTGGCTCAGG + Intergenic
1000547805 5:162623225-162623247 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1000609284 5:163356821-163356843 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1000889162 5:166783792-166783814 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1000891662 5:166809471-166809493 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1000903404 5:166935510-166935532 GTGCGTGGTCTCGCTGGCTCAGG + Intergenic
1001791910 5:174464968-174464990 GGTCATGGTATCTCTGGCTTGGG - Intergenic
1001906713 5:175478940-175478962 GCGCCTGGCCGCGCTGTCTTCGG + Intronic
1002004447 5:176221074-176221096 GTTCGGGGTCTCGCTGGCTCAGG + Intergenic
1002221925 5:177689551-177689573 GTTCGGGGTCTCGCTGGCTCAGG - Intergenic
1002465126 5:179404554-179404576 ACACCTGGTCTTGCTGGCCTAGG + Intergenic
1002616534 5:180459635-180459657 GTTCATGGTCTCGCCGGCTCGGG - Intergenic
1003170670 6:3719680-3719702 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1003224317 6:4190628-4190650 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1003577944 6:7314842-7314864 GTTCATGGTCTCACTGGCTCAGG + Intronic
1003589772 6:7427118-7427140 GTTCATGGTCTCACTGGCTCCGG - Intergenic
1003717897 6:8667441-8667463 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1003737044 6:8888097-8888119 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1003862946 6:10338446-10338468 GTTCGTGGTCTCGCTGGCTCCGG - Intergenic
1003896856 6:10616133-10616155 GTTCGTGGTCTCGCTAGCTCAGG + Intronic
1003908306 6:10721837-10721859 GATCGTGGTCTCCCTAGCTTTGG - Intergenic
1004045234 6:12017375-12017397 GTTCGTGGTCTCGCTGGTTCAGG + Intronic
1004052987 6:12107617-12107639 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1004497652 6:16180154-16180176 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1004499453 6:16197045-16197067 GTTCTAGGTCTCGCTGGCTCAGG + Intergenic
1004503042 6:16226210-16226232 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1004665364 6:17744430-17744452 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1004865876 6:19853554-19853576 GTTCGTGGTCTCGTTGGCTCAGG + Intergenic
1004906763 6:20243953-20243975 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1005035323 6:21550812-21550834 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1005042124 6:21609275-21609297 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1005059454 6:21762274-21762296 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1005117546 6:22355422-22355444 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1005332728 6:24765262-24765284 GTTCGTGGTCTCGCTAGCTCAGG + Intergenic
1005759982 6:28959192-28959214 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1005976869 6:30806868-30806890 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1006005920 6:31001439-31001461 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1006033804 6:31196652-31196674 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1006352809 6:33533559-33533581 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1006477972 6:34269959-34269981 GCTCGTTGTCTCGCTGGCTCAGG - Intergenic
1006696166 6:35932347-35932369 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1006748695 6:36363285-36363307 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1007155968 6:39744071-39744093 GCTGCTGTTCTCGCTGATTTGGG - Intergenic
1007497341 6:42269195-42269217 GGTCCGGATCTCGCTGGCCTGGG + Exonic
1007598366 6:43065990-43066012 GCTCATGGTCTCCCTGTCTCAGG - Intronic
1007601123 6:43081916-43081938 GATCCTGGGCTGGCTGGTTTTGG + Intronic
1007738885 6:43999108-43999130 GTTCGTGGTCTCGCTGGCTTAGG - Intergenic
1008038965 6:46775792-46775814 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1008254208 6:49276337-49276359 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1008270061 6:49481423-49481445 GTTTCTGGTCTCACTGGCTCAGG + Intronic
1008270353 6:49482856-49482878 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1008284145 6:49628571-49628593 GTTCGTGGTCTCCCTGGCTCAGG + Intronic
1008308388 6:49933983-49934005 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1008567989 6:52787677-52787699 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1008771169 6:54980432-54980454 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1009587824 6:65628695-65628717 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1009685521 6:66950466-66950488 ATTCGTGGTCTCGCTGGCTCGGG - Intergenic
1010066442 6:71687196-71687218 GTTCCCGGTCTCGCTAGCTCAGG - Intergenic
1010277797 6:73989960-73989982 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1010617563 6:78031014-78031036 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1011143868 6:84190642-84190664 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1011178282 6:84588595-84588617 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1011246712 6:85327279-85327301 GTTCGTGGTCTTGCTGGCTTAGG - Intergenic
1011593845 6:88997278-88997300 TTTCCTGATCTCTCTGGCTTTGG + Intergenic
1011619942 6:89233766-89233788 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1011879775 6:92010893-92010915 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1011974907 6:93283639-93283661 GCTCCTGGTCTCGCTGGCTTCGG - Intronic
1012189164 6:96260107-96260129 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1012599014 6:101071500-101071522 GTTCGTGGTCTCGCTGGGTCAGG - Intergenic
1012733412 6:102910028-102910050 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1012760344 6:103293785-103293807 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1013080379 6:106806782-106806804 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1013143399 6:107363408-107363430 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1013694646 6:112688665-112688687 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1013853191 6:114540816-114540838 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1013955148 6:115833488-115833510 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1013960240 6:115890130-115890152 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1013963260 6:115927173-115927195 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1014056051 6:117015826-117015848 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1014280988 6:119442254-119442276 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1014499112 6:122164343-122164365 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1014718734 6:124893209-124893231 GTTCTTGGTCTCGCTGGCTCAGG - Intergenic
1014739167 6:125126941-125126963 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1014788646 6:125645525-125645547 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1014920912 6:127213917-127213939 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1015572109 6:134633040-134633062 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1015600525 6:134905925-134905947 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1016069737 6:139725662-139725684 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1016092660 6:139998867-139998889 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1016217354 6:141619129-141619151 GTTCGTGGTCTCGGTGGCTCAGG - Intergenic
1016858634 6:148696445-148696467 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1016858757 6:148697332-148697354 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1017299146 6:152835486-152835508 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1017325244 6:153134648-153134670 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1017537552 6:155364307-155364329 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1017839330 6:158208986-158209008 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1018064086 6:160113905-160113927 ATTCGTGGTCTCGCTGGCTCAGG + Intergenic
1018456382 6:163956869-163956891 CCTCCTGGTCTCCCAGCCTTGGG - Intergenic
1018545838 6:164934431-164934453 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1019000091 6:168742938-168742960 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1019000106 6:168743069-168743091 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1019259134 7:70879-70901 GTTCATGGTCTTGCTGGCATTGG + Intergenic
1019344816 7:524199-524221 GCTCCTGGGCTGGATGGCTCTGG - Intergenic
1019944090 7:4313105-4313127 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
1019965578 7:4496095-4496117 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
1020008431 7:4794562-4794584 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1020552118 7:9620762-9620784 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1020662041 7:10994758-10994780 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1021324312 7:19246795-19246817 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1021567727 7:22031640-22031662 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1021686601 7:23193007-23193029 GTCCGTGGTCTCGCTGGCTCAGG + Intronic
1021761180 7:23904407-23904429 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1022075080 7:26960538-26960560 GCTCTGGGTCTCGCTGCCCTGGG - Intronic
1022173990 7:27856199-27856221 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1022750590 7:33219948-33219970 GTTCATGGTCTCGCTAGCTCAGG - Intronic
1022847523 7:34225966-34225988 GCTCCTGCTCTCTGTGGCTGGGG + Intergenic
1023128113 7:36974933-36974955 GTTCATGGTCTCGCTGGCTCAGG - Intronic
1023874760 7:44280971-44280993 GTTCCTGCTCTTCCTGGCTTAGG + Intronic
1024269236 7:47629553-47629575 GTTAGTGGTCTCGCTGGCTCAGG - Intergenic
1024335441 7:48201919-48201941 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1024678162 7:51656778-51656800 CCACCTGGTCTCTCTGGCCTTGG + Intergenic
1024735623 7:52301851-52301873 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1024735650 7:52302059-52302081 CTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1024741928 7:52363685-52363707 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
1025933352 7:66014027-66014049 GGTCCAGGTCTTGATGGCTTTGG + Intergenic
1025961901 7:66230484-66230506 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1026186922 7:68089538-68089560 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1026336053 7:69394860-69394882 GTTCGTAGTCTCGCTGGCTCAGG - Intergenic
1026512523 7:71038790-71038812 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1026516696 7:71078761-71078783 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1027561841 7:79740377-79740399 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1027563890 7:79767298-79767320 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1027579499 7:79976421-79976443 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1027579512 7:79976552-79976574 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1027667380 7:81056767-81056789 GTTCATGGTCTAGCTGGCTCAGG + Intergenic
1027674636 7:81142824-81142846 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
1027698092 7:81436125-81436147 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1027698106 7:81436256-81436278 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1027868278 7:83674566-83674588 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1028070261 7:86441640-86441662 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1028511080 7:91626887-91626909 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1028557884 7:92142690-92142712 GATCGTGGTCTCGCTGGCTCAGG + Intronic
1028778483 7:94706570-94706592 GCTCGTGGTCTCACTGGCTCAGG - Intergenic
1028852374 7:95551916-95551938 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1028989689 7:97035740-97035762 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
1029076295 7:97936969-97936991 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1029096647 7:98090239-98090261 GCTCCTGGCCTCAGTGCCTTGGG - Intergenic
1029567671 7:101349700-101349722 GTTCGTGGTCGCGCTGGCTCAGG - Intergenic
1029904112 7:104072837-104072859 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
1029988335 7:104941289-104941311 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
1030101992 7:105955197-105955219 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1030215568 7:107041654-107041676 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1030366850 7:108656424-108656446 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1030733657 7:113018481-113018503 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1030819150 7:114076135-114076157 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
1031056376 7:116997119-116997141 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1031292055 7:119950458-119950480 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1031378956 7:121061020-121061042 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1032248219 7:130231057-130231079 GTTCGTGGTCTCGCTGTCTCAGG - Intergenic
1032561448 7:132897971-132897993 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1032804614 7:135341645-135341667 GTTCCTGTGCTCTCTGGCTTTGG - Intergenic
1033065245 7:138147266-138147288 GTTCGTGGTTTCGCTGGCTCAGG - Intergenic
1033393918 7:140956120-140956142 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1033839731 7:145359696-145359718 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1033866485 7:145696741-145696763 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1033979723 7:147148770-147148792 GTTCATGGTCTCACTGACTTCGG + Intronic
1034091206 7:148364942-148364964 GTTCGTGGTCTTGCTGGCTGAGG - Intronic
1034098068 7:148427381-148427403 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1034155188 7:148950275-148950297 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1034167600 7:149038024-149038046 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1034655868 7:152729445-152729467 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1034966963 7:155397640-155397662 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1035151018 7:156873212-156873234 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1035833990 8:2728352-2728374 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
1035999418 8:4584069-4584091 GTTCGTGGTCTTGCTGGCTCAGG - Intronic
1036260623 8:7236737-7236759 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1036305990 8:7602785-7602807 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1036312660 8:7695293-7695315 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1036356837 8:8050770-8050792 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1036440886 8:8780865-8780887 GTTGGTGGTCTCGCTGGCTCAGG + Intergenic
1036557352 8:9872017-9872039 CCTCATGCTCTCGCTGCCTTCGG - Intergenic
1036801510 8:11795816-11795838 GTTCGTGGTCTCGCTGGCTCAGG - Exonic
1036901728 8:12674493-12674515 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
1036915136 8:12797295-12797317 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1037239327 8:16759697-16759719 GTTCGTGGTCTCGCTGGCTTCGG + Intergenic
1037425448 8:18750328-18750350 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1037894146 8:22640748-22640770 ACACCTGGTCTCCCTGGCTGGGG + Intronic
1037957390 8:23070088-23070110 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1037971180 8:23173083-23173105 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1037983666 8:23272999-23273021 GTTCGTGCTCTCGCTGGCTCAGG - Intronic
1038035432 8:23682724-23682746 GCTCCGGGTCGCGCTGTCTCTGG + Exonic
1038174228 8:25165688-25165710 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1038482466 8:27911080-27911102 GCTCATGGGCTCACTAGCTTGGG - Intronic
1038638436 8:29305304-29305326 GTTCGTGGTCTCGCTGGCTTGGG - Intergenic
1038639550 8:29312395-29312417 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1039061449 8:33574934-33574956 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1039068951 8:33633147-33633169 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1039285030 8:36030140-36030162 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1039637479 8:39181363-39181385 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1039942986 8:42107244-42107266 GCTCCTGTTCTCCCTGCCTCTGG - Intergenic
1040026699 8:42787825-42787847 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1040791208 8:51231925-51231947 GTTCATGGTCTGGCTGGCTCAGG - Intergenic
1040952526 8:52951861-52951883 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
1040954770 8:52969219-52969241 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1041034487 8:53775113-53775135 GTTCATGGTCTCGCTAGCTCAGG + Intronic
1041034501 8:53775214-53775236 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1041604192 8:59761249-59761271 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1041632419 8:60103195-60103217 GCTCCAGCTCTTGCTGGTTTTGG + Intergenic
1041919094 8:63163141-63163163 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1043073153 8:75664532-75664554 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1043102076 8:76059627-76059649 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1043110304 8:76171086-76171108 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
1043129776 8:76446900-76446922 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1043346586 8:79304361-79304383 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1043352337 8:79376537-79376559 GTTCGTGGTCTCGCTGCCTCAGG + Intergenic
1043640341 8:82442656-82442678 GTTCATGGTCTCACTGGCTCAGG - Intergenic
1043670779 8:82881705-82881727 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1043710026 8:83403880-83403902 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
1043857343 8:85277385-85277407 GTTCATGGTCTCGCTGGCTCAGG - Intronic
1044088650 8:87972176-87972198 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1044480081 8:92675688-92675710 GCTCCCTGTCTCTATGGCTTTGG - Intergenic
1044633319 8:94299667-94299689 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1044880511 8:96718372-96718394 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1045131776 8:99162565-99162587 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1045232171 8:100316099-100316121 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1045232184 8:100316200-100316222 GCTTGTGGTCTCGCTGGCTCAGG + Intronic
1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG + Intergenic
1045491937 8:102676618-102676640 GCTCATGATCACCCTGGCTTGGG - Intergenic
1045743182 8:105386530-105386552 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1046149191 8:110201912-110201934 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1046208721 8:111040127-111040149 GTTCTTGGTCTCACTGACTTCGG + Intergenic
1046208738 8:111040226-111040248 GCTCGTGGTCTCGCTGGCTCAGG + Intergenic
1046265230 8:111822518-111822540 GTTCGTGGTCTCGCTGACTCAGG + Intergenic
1046284905 8:112082371-112082393 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1046445501 8:114312427-114312449 GTTCGTGGTCTCGCTGGCTAAGG - Intergenic
1046450848 8:114387079-114387101 GCTCATGGTCTCGCTGGCTCAGG - Intergenic
1047100033 8:121666634-121666656 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1047940208 8:129822094-129822116 GCTCTTGGTCTTGCTGTCATGGG - Intergenic
1048575876 8:135689687-135689709 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1048757336 8:137754411-137754433 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1048789368 8:138085393-138085415 GTTCGTGGTCTCCCTGGCTCAGG - Intergenic
1048789382 8:138085523-138085545 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1049087471 8:140489725-140489747 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1049157856 8:141077847-141077869 GTTCGCGGTCTCGCTGGCTCAGG - Intergenic
1049858095 8:144876427-144876449 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1050250097 9:3734707-3734729 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1050250113 9:3734808-3734830 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
1051304904 9:15699170-15699192 GTTCTTGGTCTCGCTGGTTCAGG + Intronic
1051304922 9:15699271-15699293 GCTCGTGGGCTCGCTGGCTCAGG + Intronic
1051419546 9:16876109-16876131 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1051449240 9:17177599-17177621 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1051463961 9:17355007-17355029 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1051892827 9:21960116-21960138 GTTCCTGGTCTCGCTGGCTCAGG - Intronic
1051892839 9:21960247-21960269 GTTCGTGGTCTCGTTGGCTCAGG - Intronic
1052056523 9:23913733-23913755 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1052075618 9:24136142-24136164 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1052313591 9:27093728-27093750 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1052979719 9:34439090-34439112 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1052985165 9:34481653-34481675 GTTCGTGGTTTCGCTGGCTCAGG + Intronic
1053027132 9:34739623-34739645 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1053436279 9:38076739-38076761 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1053547753 9:39041683-39041705 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1053811845 9:41861325-41861347 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1054618750 9:67326114-67326136 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1055102407 9:72479515-72479537 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1055461305 9:76523067-76523089 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1055557429 9:77489652-77489674 GTTTGTGGTCTCGCTGGCTCAGG + Intronic
1055651538 9:78411139-78411161 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1055778833 9:79796758-79796780 GCTTCTGGTCTTTCTGGCTGTGG + Intergenic
1056080779 9:83092424-83092446 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1056219439 9:84436699-84436721 GTTCCTAGCCTCACTGGCTTTGG + Intergenic
1056743916 9:89283497-89283519 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1056771228 9:89479638-89479660 GTTCGTGGTCTCGCTGGCTCGGG + Intronic
1057118343 9:92546562-92546584 GTTCGTGGTCTCGCTGGCTCAGG - Intronic
1057543699 9:96001004-96001026 GTTCATGGTCTCGCTGGCTCAGG + Intronic
1057628438 9:96699798-96699820 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1058174692 9:101723276-101723298 GTTCATGGTCTCGCTGGCTCGGG + Intronic
1058235524 9:102486118-102486140 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1058235540 9:102486249-102486271 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1058585220 9:106500593-106500615 GTTCGTGGTCTCGCTGGCTCCGG + Intergenic
1058727681 9:107818821-107818843 GTTCATGGTCTCGCTGGCTCTGG - Intergenic
1058786667 9:108394706-108394728 GTTCGTGGTCTCGCTGGCTCGGG - Intergenic
1058799511 9:108531144-108531166 GTTCGTGGTCTCGCTGGTTCAGG - Intergenic
1058904135 9:109467735-109467757 GCTCCTGCTCGTGCTGGCGTGGG + Intronic
1059791002 9:117642051-117642073 GTTCGTAGTCTCGCTGGCTCAGG + Intergenic
1059810780 9:117853060-117853082 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
1059891304 9:118808560-118808582 GTTCGTGGTCTCGCTGGTTCAGG + Intergenic
1059991395 9:119869493-119869515 GTTCCTGGTCTCACTGGCTCAGG + Intergenic
1060305204 9:122405384-122405406 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1060594056 9:124837902-124837924 GTTCGTGGTCTCGCTGGCTCGGG + Intergenic
1061483992 9:130911185-130911207 GTTCGTGGTCTAGCTGGCTCAGG - Intronic
1061517594 9:131098513-131098535 GCTCAGGGTCCCGCTGGCTGTGG - Intronic
1061616245 9:131781329-131781351 GCTTCTGGTCTCGCTGGCTGTGG - Intergenic
1061870766 9:133519138-133519160 CCTCAGGGTCTCGCTGGCTGAGG - Intronic
1061890162 9:133615036-133615058 CCTCCTCATCTGGCTGGCTTGGG + Intergenic
1061996838 9:134190482-134190504 GCTGCTGGCCTCGCTGGCCCCGG - Intergenic
1062146050 9:134990328-134990350 GTTCGCGGTCTCGCTGGCTCAGG + Intergenic
1062745581 9:138209606-138209628 GTTCATGGTCTTGCTGGCATTGG - Intergenic
1203429947 Un_GL000195v1:81345-81367 GCTCGTGGTCTCGCTGGCTCAGG - Intergenic
1203662504 Un_KI270753v1:58247-58269 GTTCGTGGTCTGGCTGGCTCAGG - Intergenic
1203670885 Un_KI270755v1:10564-10586 GTTCGTGGTCTGGCTGGCTCAGG + Intergenic
1186152428 X:6689715-6689737 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1186293341 X:8122537-8122559 ATTCGTGGTCTCGCTGGCTCAGG - Intergenic
1186295515 X:8144454-8144476 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1186323114 X:8451911-8451933 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1187005686 X:15230901-15230923 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1187139220 X:16576544-16576566 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1187304769 X:18084995-18085017 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1187557415 X:20366107-20366129 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1187904191 X:24050975-24050997 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1188112163 X:26205892-26205914 GTTCGTGATCTCGCTGGCTCAGG - Intergenic
1188166804 X:26872992-26873014 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1188189760 X:27158796-27158818 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1188242827 X:27810273-27810295 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1189209993 X:39276666-39276688 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1189225464 X:39409709-39409731 GCTGGTGTTCTCACTGGCTTGGG - Intergenic
1189896692 X:45664069-45664091 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1190045599 X:47109506-47109528 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1190413771 X:50162256-50162278 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1191618463 X:63191698-63191720 GTTCGTGGTCTCGCTGGCACAGG + Intergenic
1192186915 X:68953230-68953252 GTTCGTGGTTTCGCTGGCTCAGG - Intergenic
1192869505 X:75172687-75172709 GTTCGTGGTCTCGCTGGCTTAGG + Intergenic
1192870411 X:75178604-75178626 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1193537961 X:82737173-82737195 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1193708801 X:84855771-84855793 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1193803853 X:85971407-85971429 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1193951612 X:87807971-87807993 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1194025447 X:88745651-88745673 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1194071448 X:89330198-89330220 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1194121057 X:89964771-89964793 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1194451214 X:94046548-94046570 GTTCGTAATCTCGCTGGCTTCGG - Intergenic
1195257854 X:103106433-103106455 GTTCGTGGCCTCGCTGGCTCAGG + Intergenic
1195460136 X:105115176-105115198 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1195896165 X:109748146-109748168 GTTCGTGTTCTCGCTGGCTCAGG + Intergenic
1196319367 X:114269815-114269837 GCTCGTGGGCTCGCTGGCTTCGG + Intergenic
1196582865 X:117395917-117395939 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1196616316 X:117770212-117770234 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1196662347 X:118281791-118281813 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1196705722 X:118715981-118716003 GTTCGTGGTCTCCCTGGCTCAGG + Intergenic
1196728784 X:118921310-118921332 GTTCCTGGTCTCGCTGGCTCAGG + Intergenic
1196761801 X:119207524-119207546 GTTCCTGGTCTCGCTGGCTCAGG + Intergenic
1196762090 X:119209240-119209262 GTTCGCGGTCTCGCTGGCTCAGG + Intergenic
1196771678 X:119300980-119301002 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1196775382 X:119333187-119333209 GTTTGTGGTCTCGCTGGCTCTGG - Intergenic
1196775663 X:119334690-119334712 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1196793792 X:119486800-119486822 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1196845210 X:119891669-119891691 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1197000107 X:121430695-121430717 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1197331017 X:125154751-125154773 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1197340209 X:125256705-125256727 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1197344670 X:125318255-125318277 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1197376649 X:125689907-125689929 GTTCATGGTCTCACTGGCTCAGG + Intergenic
1197533613 X:127662165-127662187 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1197533627 X:127662266-127662288 GTTCGTCGTCTCGCTGGCTCAGG + Intergenic
1197978898 X:132195122-132195144 GTTTGTGGTCTCGCTGGCTCAGG - Intergenic
1198061083 X:133045677-133045699 GTTTGTGGTCTCGCTGGCTCAGG - Intronic
1198300174 X:135326808-135326830 GTTCGTGGTCTCGCGGGCTCAGG - Intronic
1198468276 X:136922582-136922604 GTTCATGGTCTCGCTGGATCAGG - Intergenic
1198664150 X:139003192-139003214 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1198694606 X:139321871-139321893 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1198872172 X:141187924-141187946 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1198972432 X:142297511-142297533 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1199009754 X:142744770-142744792 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1199028621 X:142971209-142971231 GTTCATGGTCTCGCTGGCTCAGG + Intergenic
1199050081 X:143228079-143228101 GTTGGTGGTCTCGCTGGCTCAGG + Intergenic
1199134011 X:144230538-144230560 GTTCGTGGCCTCGCTGGCTCAGG + Intergenic
1199356067 X:146866009-146866031 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1199628283 X:149759782-149759804 GTTCGTGGTCTCGCCGGCTCAGG - Intergenic
1199682093 X:150232337-150232359 GGTCCTGGCCTGGCTGGCTTTGG + Intergenic
1199831141 X:151550505-151550527 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1199832780 X:151561910-151561932 GTTCGTGGTCTTGCTGGCTCAGG + Intergenic
1200148953 X:153942142-153942164 GCCCCTGGACCTGCTGGCTTGGG + Intronic
1200423398 Y:2997537-2997559 GTTTGTGGTCTCGCTGGCTCAGG + Intergenic
1200473911 Y:3622263-3622285 GTTCGTGGTCTCGCTGGCTCAGG + Intergenic
1200725682 Y:6665929-6665951 GTTCTTGGTCTCGCTGGCTCAGG + Intergenic
1200888855 Y:8299929-8299951 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1200973943 Y:9187630-9187652 GTTCATGGTCTCGCTGGCTCAGG - Intergenic
1201429336 Y:13889177-13889199 GTTCATGGTCTTGCTGGCTCAGG - Intergenic
1201469252 Y:14315670-14315692 GTTCGTGGTCTTGCTGGCTCAGG - Intergenic
1201480096 Y:14429287-14429309 CTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1201495532 Y:14588834-14588856 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1201496761 Y:14597086-14597108 GTTCGTGGTCTCGCTGGCTCAGG + Intronic
1201499398 Y:14626472-14626494 GTTCGTGGTCTCGCTGACCTCGG + Intronic
1201555400 Y:15261076-15261098 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
1201556431 Y:15268196-15268218 GTTCCTTGTCTTGCTGGCTCAGG - Intergenic
1201573103 Y:15434369-15434391 GTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1201715971 Y:17044144-17044166 GTTCGTGGTCTCGCTGACTCAGG - Intergenic
1201885927 Y:18881274-18881296 GTTCCTGGTCTCGCTGGCTCAGG - Intergenic
1202109992 Y:21408335-21408357 CTTCGTGGTCTCGCTGGCTCAGG - Intergenic
1202136935 Y:21675995-21676017 GTTCATGGTCTTGCTGGCTCAGG + Intergenic
1202257511 Y:22937366-22937388 GTTCATGGTCTCGCTGACTTCGG - Intergenic
1202410501 Y:24571113-24571135 GTTCATGGTCTCGCTGACTTCGG - Intergenic
1202460280 Y:25098959-25098981 GTTCATGGTCTCGCTGACTTCGG + Intergenic