ID: 1011977641

View in Genome Browser
Species Human (GRCh38)
Location 6:93325003-93325025
Sequence GAACCTACCTTTTCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011977639_1011977641 4 Left 1011977639 6:93324976-93324998 CCTGAAAAAAGGCATTTTTTTTC 0: 1
1: 0
2: 12
3: 102
4: 1062
Right 1011977641 6:93325003-93325025 GAACCTACCTTTTCTAAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011977641 Original CRISPR GAACCTACCTTTTCTAAAAC TGG Intronic
904131331 1:28277711-28277733 GCACGTACCTTTTTTAAAATTGG - Intronic
905026915 1:34856842-34856864 GAACCTGGCTTTTCTAACAATGG + Intronic
906348195 1:45034443-45034465 GAAGCTGAGTTTTCTAAAACAGG + Exonic
907794076 1:57696714-57696736 GATCTTACCCTTTCTAAAACAGG + Intronic
908327680 1:63039614-63039636 AAACTTACCATATCTAAAACTGG + Intergenic
910773132 1:90850236-90850258 GACCAAACATTTTCTAAAACTGG - Intergenic
912533516 1:110344033-110344055 GAACCTTCCTTCTCTCAAAATGG - Intronic
913482539 1:119302824-119302846 GGACCTGCCTTTTCTAGAAGGGG - Intergenic
918149576 1:181786513-181786535 GAACTTACTTTTTCTATAATAGG + Intronic
918439891 1:184556250-184556272 GCAGGTTCCTTTTCTAAAACTGG - Intronic
920141238 1:203815157-203815179 AAACCTAACTGTTCAAAAACTGG - Intronic
920241418 1:204554427-204554449 GATGCTACCTTTGCTAAAAATGG + Exonic
920598419 1:207296988-207297010 GATTCTACCTTTTCTAAAAAGGG + Intergenic
921822719 1:219636133-219636155 AAACATTCCTTCTCTAAAACAGG - Intergenic
922299330 1:224282727-224282749 AAATCTACCACTTCTAAAACTGG + Intronic
1063851503 10:10197737-10197759 TAACCTATCTTCTCTAAAAAAGG - Intergenic
1063863203 10:10334655-10334677 GAACCAACCTCTACTAAACCTGG + Intergenic
1066610420 10:37241185-37241207 GAATCTATATTTTCTGAAACTGG + Intronic
1066816562 10:39425039-39425061 GATCATTCCTTTTCTACAACAGG + Intergenic
1068351104 10:55846281-55846303 GAACTTGCATGTTCTAAAACAGG - Intergenic
1071205386 10:83269993-83270015 GTACCTACCTTTCATAAAATAGG - Intergenic
1074507672 10:114085967-114085989 GAACTTACCCTTTCTATTACAGG + Intergenic
1075122635 10:119675562-119675584 GATCGTATCTTTTCTAAAACAGG + Intronic
1075825191 10:125350327-125350349 GAACCTTTCTGTTCTAAAGCAGG + Intergenic
1079919754 11:26418409-26418431 GAACCTCCCCATTCTGAAACAGG + Intronic
1080399635 11:31922056-31922078 GAACCCCCGTTCTCTAAAACAGG - Intronic
1080554727 11:33405917-33405939 GAGCCTTCCTCTTCTAAAAATGG - Intergenic
1082163491 11:48911659-48911681 GAACATACCTTTTCATAGACCGG - Intergenic
1082163795 11:48917282-48917304 GAACATACCTTTTCTTAGAGCGG - Intergenic
1083957932 11:65996727-65996749 GAATCTCCCATTTCTGAAACAGG - Exonic
1087871863 11:103304706-103304728 GAATCTACCTTTTCCAGAACTGG - Exonic
1089805963 11:121089829-121089851 GAACATACCTTTTCTAAAATAGG + Exonic
1090687409 11:129138959-129138981 AAACCTACCATGTCTAAAACAGG + Intronic
1093302445 12:17473038-17473060 TATCCTACCTGTCCTAAAACCGG + Intergenic
1094187484 12:27660545-27660567 AAACATAACGTTTCTAAAACAGG - Intronic
1097739056 12:63217494-63217516 GTAGCTTCCTTTTATAAAACAGG - Intergenic
1098107723 12:67087898-67087920 GAAACTACCAATTCTAAAAATGG + Intergenic
1100665176 12:96743842-96743864 GAATCTCCCTCTTCAAAAACAGG + Exonic
1101959297 12:109236616-109236638 AAACCTACCTGTTCTACAACAGG - Intronic
1104131299 12:125896922-125896944 GAAGATGCCTGTTCTAAAACTGG + Intergenic
1104530158 12:129562616-129562638 GAACCTCAATTTTCTAATACGGG + Intronic
1107033372 13:35876375-35876397 GTAACTACGTTTTCTAAAATGGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108009858 13:45994833-45994855 GCACCTTCCTCTTCCAAAACTGG - Intronic
1111921165 13:94412557-94412579 GAACCTTCCCTTTCTATGACAGG - Intergenic
1112337852 13:98529213-98529235 CTACCTACCATTTCTAAAGCTGG + Intronic
1112347325 13:98601194-98601216 CAACCTTCATTTTCCAAAACAGG + Intergenic
1112591562 13:100767994-100768016 GGCCCTGCCTTTTCTAAAACTGG - Intergenic
1113128659 13:107009478-107009500 GAATCTACTTTTTAAAAAACTGG + Intergenic
1113294629 13:108945042-108945064 GAATCCATCTTTTGTAAAACAGG + Intronic
1115397966 14:32931592-32931614 GAAACTTTGTTTTCTAAAACAGG - Intergenic
1117808900 14:59524405-59524427 CAACCTACTTTTTAAAAAACGGG + Intronic
1123231555 15:17124221-17124243 GATACTTCCTTTTCCAAAACAGG - Intergenic
1126912989 15:53434796-53434818 GAACCTACATTTCCAAACACTGG + Intergenic
1127827798 15:62720024-62720046 GAACCCACCTCTCCTGAAACTGG - Intronic
1129941150 15:79497655-79497677 CCTCCTACCTTTTCTAAAGCAGG - Intergenic
1129994139 15:79990379-79990401 GAAGGTACCTTTTATTAAACGGG - Intergenic
1131768061 15:95701744-95701766 GAAACTCCCATTTTTAAAACTGG + Intergenic
1135135006 16:19880962-19880984 TAACCTACCTTCTCTAAAGATGG + Intronic
1137859917 16:51836270-51836292 GAACCTACATCTTTTAATACTGG - Intergenic
1138048056 16:53746530-53746552 GAAACTACATTCTCTAAAGCTGG - Intronic
1141124614 16:81392305-81392327 GGACAGACCTTTTCTGAAACTGG + Intergenic
1143988717 17:10938430-10938452 TAACCTACCTTCTCTCCAACTGG - Intergenic
1144499209 17:15770690-15770712 CAACCTGAATTTTCTAAAACAGG + Intergenic
1145162600 17:20585723-20585745 CAACCTGAATTTTCTAAAACGGG + Intergenic
1149713392 17:58763424-58763446 GGACCTACATTTCCTAAAAAAGG + Intronic
1152496901 17:80679644-80679666 CAACCTGCCTTTTTCAAAACAGG - Intronic
1157938345 18:51897850-51897872 AAAACTTCCTTTTCAAAAACAGG + Intergenic
1163073413 19:14865592-14865614 GAACTTTCCTTTTGTAAAATGGG - Intergenic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
925796124 2:7544681-7544703 GAACCTACATCTTTTAAAACAGG - Intergenic
932099904 2:68889351-68889373 GACCTGGCCTTTTCTAAAACTGG - Intergenic
932769491 2:74492574-74492596 AAAAGTACCCTTTCTAAAACTGG - Intronic
937568279 2:123323916-123323938 AAAGCTACCTTTTCCAAAAAAGG + Intergenic
939026672 2:137022255-137022277 GAAACTACCTGTTTTTAAACTGG + Intronic
939181343 2:138806040-138806062 GAACCTACATGTTCTTCAACAGG - Intergenic
939892434 2:147753146-147753168 GAACTTAATTTTTCTAACACTGG + Intergenic
941026651 2:160463201-160463223 GAACCTCTTTTTTCTAGAACAGG - Intronic
943052680 2:182935703-182935725 GCCCCTACCTTTTCTGAAATAGG - Intronic
943771938 2:191727313-191727335 TACTCTATCTTTTCTAAAACTGG + Intergenic
947015217 2:225612002-225612024 GAATGTGACTTTTCTAAAACTGG - Intronic
1170182040 20:13542542-13542564 GAAACTTTCTTTTCTAAAATTGG - Intronic
1171912700 20:30979477-30979499 GAACATACCTTTTCTTAGAGCGG - Intergenic
1177329883 21:19644842-19644864 ACACCTAACATTTCTAAAACAGG - Intergenic
1177622056 21:23608923-23608945 GAACCAAGCTTTACTATAACTGG + Intergenic
1177851216 21:26350942-26350964 GAACCTATCTTCTCTATAACAGG - Intergenic
1183878159 22:40802158-40802180 GAAGCTACCTCTTCAAACACTGG + Intronic
949950931 3:9228218-9228240 GCACATACCTTGTCTAAAAAAGG + Intronic
950376738 3:12578607-12578629 AAAGCTACCTTTTTTAAAAAAGG + Intronic
957633539 3:82750572-82750594 GAACCTAAGTTTTTTAAATCTGG + Intergenic
958273455 3:91540257-91540279 GAACCTTCCTTTTCACAGACCGG - Intergenic
959241370 3:103799305-103799327 AAAACTACCTTTTCAAAAAGCGG - Intergenic
961564939 3:127756649-127756671 CAACCTACATTTTCAAACACAGG + Intronic
963667996 3:148214756-148214778 AAACCTTGCTTTTCTAAATCAGG - Intergenic
964689113 3:159430369-159430391 CAACCTACCTTTTTAAAATCAGG + Intronic
964738526 3:159941557-159941579 GAAGCTAACTTTCCTAAAAATGG + Intergenic
965154972 3:165039879-165039901 GAGCCTACCTGTTTTAGAACAGG + Exonic
966956677 3:184887772-184887794 GACCCAACCTTTTCTGAATCAGG - Intronic
967780662 3:193436224-193436246 GTCCCAACTTTTTCTAAAACTGG + Intronic
971628514 4:28957475-28957497 TAAGCTACATCTTCTAAAACTGG + Intergenic
975651254 4:76595831-76595853 GAAACTTGCTTATCTAAAACAGG - Intronic
975747235 4:77486532-77486554 GAGCCCACATTTTCTAGAACTGG - Intergenic
976848824 4:89521366-89521388 ACACTTACCTTTTCTAAAATAGG - Intergenic
977875042 4:102139686-102139708 AAACATCCCTTTTGTAAAACAGG + Intergenic
979346898 4:119598725-119598747 GCACCTGCCTTCTCTAAAGCAGG - Intronic
979817315 4:125125846-125125868 GAAATTACCTTTTGTAAAAAAGG - Intergenic
981917081 4:150046243-150046265 GTTCCTACCATTTCTAAAAAGGG - Intergenic
984671772 4:182497648-182497670 CAACCTAACTTTTTAAAAACAGG + Intronic
987767191 5:22247968-22247990 GATCCTACCTTTTGTAAGGCAGG + Intronic
989896515 5:47094148-47094170 GATACTGCCTTTTCTAAAAGAGG + Intergenic
989923512 5:49840522-49840544 GATATTACCTTTTCTACAACGGG - Intergenic
990648586 5:57872084-57872106 CAATTTACCTTTTCTCAAACAGG + Intergenic
992706976 5:79406011-79406033 ATACCAACCTTTTCTTAAACAGG - Intronic
993233728 5:85275202-85275224 GACACTACATTTTCTAAAAATGG + Intergenic
1000801234 5:165728796-165728818 TAACTTACATTTTCCAAAACTGG - Intergenic
1000836784 5:166164935-166164957 AAACCTCCTTTTTCTCAAACAGG - Intergenic
1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG + Intronic
1000982936 5:167836032-167836054 GAATATACCTTTTTTAAAACTGG + Intronic
1001124778 5:169009575-169009597 GAAGCTACCTTTCCTAAAAGGGG + Intronic
1202772193 5_GL000208v1_random:17506-17528 GATACTGCCTTTTCTAAAAGAGG + Intergenic
1003001789 6:2342468-2342490 GAAAGTACCTTTACTAAAGCTGG + Intergenic
1004779016 6:18884523-18884545 GAATCTACCTTTTCTAAGGAGGG + Intergenic
1007239750 6:40416496-40416518 GAACTGACCTTTTCTTACACTGG + Intronic
1007996856 6:46316766-46316788 CAGCCTACCTTTCCTAGAACAGG - Intronic
1008589985 6:52984456-52984478 CCACCTACCTTTTCAAACACAGG + Exonic
1011977641 6:93325003-93325025 GAACCTACCTTTTCTAAAACTGG + Intronic
1012661594 6:101902843-101902865 GAACCTATTTCTTCTAATACAGG - Intronic
1013218121 6:108049172-108049194 GTAGCTATCATTTCTAAAACAGG + Intronic
1013558106 6:111277672-111277694 CTACTTTCCTTTTCTAAAACTGG - Intergenic
1013675518 6:112457144-112457166 GAGCCTATTTTTTTTAAAACAGG - Intergenic
1015952751 6:138570376-138570398 GAACTTTACTTTTCTAAATCAGG - Intronic
1016492346 6:144620635-144620657 AAACCTACCTTCTCTAATAAAGG + Intronic
1017461696 6:154656897-154656919 AAAACTACCTTTTCTTAAAGTGG + Intergenic
1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG + Intronic
1023616057 7:42021007-42021029 GCACCTACCTATTCTATAACAGG + Intronic
1027114372 7:75467143-75467165 GACACTGCATTTTCTAAAACTGG - Intronic
1030935171 7:115576700-115576722 CAACCTACTTTTTGTAAATCCGG + Intergenic
1031386117 7:121153031-121153053 AAACCTTTCTTTACTAAAACCGG + Intronic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1036726151 8:11223071-11223093 AAAACTACCATTTATAAAACCGG + Intergenic
1038811472 8:30850398-30850420 AAAAATACCTTTCCTAAAACAGG + Intronic
1039405110 8:37306015-37306037 GATCCTTCATTTTCTAAATCAGG - Intergenic
1040192727 8:44736740-44736762 GAACCTTCCGTTTCTAGAGCAGG + Intergenic
1042406163 8:68407917-68407939 GAATGTTCCTTTTATAAAACAGG - Intronic
1043389120 8:79774463-79774485 TAGGCTTCCTTTTCTAAAACTGG - Intergenic
1046238295 8:111456792-111456814 AAACCTATCTTTTTTAAAACTGG + Intergenic
1048571023 8:135656393-135656415 GAACCTACTTTTTTAAAAAACGG + Intronic
1048804620 8:138228574-138228596 AAACCTACCTTGTCAAACACAGG - Intronic
1048887229 8:138918230-138918252 GCCCCTACCTTGTCTAAAACAGG - Intergenic
1051447575 9:17156404-17156426 AAACCAACCTTTTTTAAAAAAGG - Intronic
1052428802 9:28339162-28339184 TAACTTACCTATTCTAAAAAGGG - Intronic
1053711641 9:40816725-40816747 GAAACTTCCTTTTCTACCACAGG - Intergenic
1053937774 9:43184183-43184205 GAAACTTCCTTTTCTACCACAGG - Intergenic
1054422106 9:64948601-64948623 GAAACTTCCTTTTCTACCACAGG - Intergenic
1055329122 9:75163756-75163778 GAAACTACCTTTTGGAAAAATGG - Intergenic
1057887084 9:98838172-98838194 GAAGCTTCCTTTTCTAAAACAGG + Intronic
1058618041 9:106856119-106856141 GAACCTACTTTTTATAAGACTGG - Intergenic
1059179503 9:112198557-112198579 GCAGCCACCTTTTTTAAAACAGG + Intergenic
1203353748 Un_KI270442v1:111092-111114 GAACATACCTTTTCTTAGAGCGG + Intergenic
1203374718 Un_KI270442v1:358093-358115 GATATTTCCTTTTCTAAAACTGG - Intergenic
1203404078 Un_KI270511v1:5744-5766 GATACTTCCTTTTCCAAAACAGG + Intergenic
1203398917 Un_KI270519v1:61025-61047 GATATTCCCTTTTCTAAAACAGG - Intergenic
1191568229 X:62569499-62569521 GATACTTCCTTTTCCAAAACAGG - Intergenic
1197633197 X:128885746-128885768 GAACCTACACTTTCTCATACAGG + Intergenic
1199141551 X:144319816-144319838 GACCCTATATTTTCTAAATCCGG - Intergenic
1199962780 X:152791319-152791341 GAACTTCCCTTTCCTAAAATTGG - Intergenic