ID: 1011982704

View in Genome Browser
Species Human (GRCh38)
Location 6:93403045-93403067
Sequence ACATAAACAAGACTGTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011982704_1011982705 18 Left 1011982704 6:93403045-93403067 CCAGAAGACAGTCTTGTTTATGT No data
Right 1011982705 6:93403086-93403108 TTATCCTGTTATTTGCTATGAGG 0: 1
1: 0
2: 2
3: 17
4: 195
1011982704_1011982707 25 Left 1011982704 6:93403045-93403067 CCAGAAGACAGTCTTGTTTATGT No data
Right 1011982707 6:93403093-93403115 GTTATTTGCTATGAGGAAAATGG 0: 1
1: 0
2: 4
3: 32
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011982704 Original CRISPR ACATAAACAAGACTGTCTTC TGG (reversed) Intronic