ID: 1011983851

View in Genome Browser
Species Human (GRCh38)
Location 6:93418685-93418707
Sequence CTGCGTCGGAGGCGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 7, 3: 158, 4: 623}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011983851_1011983858 26 Left 1011983851 6:93418685-93418707 CCGCGCCGCCGCCTCCGACGCAG 0: 1
1: 0
2: 7
3: 158
4: 623
Right 1011983858 6:93418734-93418756 TTCCGAGCTCATCGAAGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011983851 Original CRISPR CTGCGTCGGAGGCGGCGGCG CGG (reversed) Intronic
900135818 1:1116509-1116531 CTTCATCGGAGAAGGCGGCGCGG + Intergenic
900284049 1:1890849-1890871 CGGCGGCCGAGGCGGCGGTGTGG - Exonic
901045409 1:6393105-6393127 GGGCGTCCGGGGCGGCGGCGCGG + Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
902323645 1:15684490-15684512 CGGCGCGGGAAGCGGCGGCGGGG + Exonic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
903190167 1:21651904-21651926 CTGGGGCGGGGGCGGGGGCGGGG - Intronic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
904620454 1:31772032-31772054 CCGTGGCGGCGGCGGCGGCGCGG + Intergenic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905212775 1:36385857-36385879 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906140595 1:43531539-43531561 GTGCGGCGGGGGCGGGGGCGCGG - Intronic
906525243 1:46489841-46489863 TGGCAGCGGAGGCGGCGGCGCGG + Intergenic
906717933 1:47984229-47984251 CTGCGGTGGAGGAGGCGGCGCGG - Intronic
907010725 1:50960242-50960264 CAGGGGCGGAGGCGGCGGCCAGG - Exonic
907184949 1:52602417-52602439 CGGCGACGGTGGCAGCGGCGTGG + Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
908131198 1:61077132-61077154 CTGCGGCGGAGGGGGCAGGGAGG - Intronic
910759108 1:90718026-90718048 CGGCCTCGGTGGCGGGGGCGCGG - Intergenic
911072980 1:93847006-93847028 CTGGGTCGGGCGCGGCGGCCGGG + Intronic
912174686 1:107141235-107141257 CTGCGGCGGTGGCGGCGGCTCGG + Intronic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913161853 1:116152295-116152317 CAGCGTGGGCGGAGGCGGCGGGG - Intergenic
914244371 1:145874821-145874843 CTGAGCCGGCGGCGGCGGGGCGG - Exonic
914889768 1:151612288-151612310 CTGCGCCGGGAACGGCGGCGGGG + Exonic
915511312 1:156388468-156388490 CAGGGCCGGAGGCGGCGGTGGGG - Intergenic
915568216 1:156728603-156728625 CGGCGGAGGAGGGGGCGGCGTGG + Exonic
915616990 1:157046224-157046246 CGGTGGCGGTGGCGGCGGCGGGG - Intergenic
916497242 1:165356732-165356754 CTGCGTGCGCGGCGGCGGAGAGG + Intergenic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917846673 1:179025966-179025988 CTGTGGCGGCGGCGGCGGCTGGG + Exonic
917974408 1:180229941-180229963 CGGAGGCGGAGGCGGAGGCGGGG + Intergenic
918055869 1:181022096-181022118 CTGGGAGGGAGGCGGGGGCGGGG - Intronic
918064263 1:181089090-181089112 CTGCTGCGGTGGCGGCGCCGGGG - Exonic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
921947149 1:220894100-220894122 CTGCCTCGTAGGCAGCGGTGGGG + Intergenic
923007906 1:230067041-230067063 CGGCCTCGGAGGCGGCGAGGGGG - Intronic
923631147 1:235650093-235650115 CTGGGGCGGGGGCGGGGGCGGGG - Intronic
924286539 1:242493564-242493586 CAGCTTTGGAGGTGGCGGCGAGG - Intronic
924289725 1:242524715-242524737 CCGGGGCGGCGGCGGCGGCGGGG + Intergenic
924414891 1:243849594-243849616 CTGGACCGGGGGCGGCGGCGAGG - Intronic
924436683 1:244048905-244048927 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
924539927 1:244970824-244970846 CTGCGCCGGAGGCGCCGGCAGGG + Exonic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
924816701 1:247448215-247448237 CGGCGGCGGCGACGGCGGCGAGG + Intronic
1062843776 10:689664-689686 CCGAGGAGGAGGCGGCGGCGCGG + Exonic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064230810 10:13528535-13528557 GTGCGGGGAAGGCGGCGGCGGGG + Intronic
1064230925 10:13528889-13528911 CGGCGGCGGCGGCGGAGGCGGGG + Intronic
1064274196 10:13891771-13891793 CCGCGGCGGGGGCGGCGGCGGGG - Intronic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464801 10:35641984-35642006 CGGCGGCGGCGGCGGCGGCTTGG - Exonic
1067972715 10:50991307-50991329 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1068204177 10:53827434-53827456 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1069761808 10:70816241-70816263 CTGCGGCCGGGGCGGGGGCGGGG + Intronic
1070153569 10:73819809-73819831 CTCTGGCAGAGGCGGCGGCGTGG - Intronic
1070327916 10:75400080-75400102 CGGTGGCGGGGGCGGCGGCGGGG - Exonic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1070835921 10:79446677-79446699 CGGAGGCGGAGGCGGGGGCGGGG - Intergenic
1070877389 10:79826386-79826408 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071618172 10:87094969-87094991 CCGCGGCGGAGGCGGAGGCCCGG - Intronic
1072287197 10:93927448-93927470 CTGCTTCGGAGGCTGAGGCAGGG + Intronic
1072679958 10:97499159-97499181 ATGCACCGGAGGCGGCGGGGTGG - Exonic
1072719499 10:97771929-97771951 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1072731497 10:97849968-97849990 CTTTGGCGGCGGCGGCGGCGGGG - Intergenic
1072757569 10:98030865-98030887 CGGCGGCGAAGGCGGCGGCGAGG + Intergenic
1073101059 10:101006902-101006924 CTGCAGCGGGAGCGGCGGCGGGG + Exonic
1073808362 10:107125061-107125083 CTGCTTGGGAGGCGGAGGCAGGG - Intronic
1074182577 10:111077294-111077316 CCGGGACGGCGGCGGCGGCGGGG - Exonic
1074503355 10:114045005-114045027 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075519524 10:123135590-123135612 CGGTGGCGGAGGCGGCTGCGGGG + Intergenic
1075768813 10:124916808-124916830 CTGCGCCGGCGGCGGCCTCGGGG + Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076650102 10:131981738-131981760 GTGAGGCGGAGGAGGCGGCGCGG - Intronic
1076673788 10:132137315-132137337 CTGCGTGGGGAGCGGAGGCGTGG - Intronic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076871489 10:133197150-133197172 CGGCGGAGGAGGCGGCGGCCTGG - Intronic
1076908206 10:133373590-133373612 CTGGGGCGGGGGCGGGGGCGCGG - Exonic
1076911917 10:133394554-133394576 CTGGGTCCGAGGCTGCGCCGCGG - Intronic
1077201474 11:1309562-1309584 CTCCGTCGCAGGCTCCGGCGGGG - Exonic
1077877506 11:6320426-6320448 CTGTGCCCGAGGCGCCGGCGGGG - Exonic
1078316055 11:10294112-10294134 CCGGGTGGGCGGCGGCGGCGAGG - Exonic
1078631732 11:13009712-13009734 CAGCGGCGGAGCCGGCGGCTGGG + Intergenic
1079459766 11:20669497-20669519 CTGGCGCGGCGGCGGCGGCGTGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080503768 11:32893157-32893179 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1081574303 11:44309745-44309767 CTGCGGCTGCGGCGGCGGCTGGG + Exonic
1081805014 11:45885744-45885766 CTGCGAAGGAGGCGGAGGCGCGG - Exonic
1083171096 11:60924507-60924529 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1083329612 11:61891458-61891480 CGGCGGCGGAGGCGGCGCCCGGG - Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083648267 11:64185651-64185673 CTGTGTCGCCGGCGGCTGCGGGG - Exonic
1083659807 11:64246782-64246804 CCGCGGCGAGGGCGGCGGCGGGG + Exonic
1083728870 11:64642720-64642742 CGGCGGTGGAGGCGGCGGCAGGG + Intronic
1083769048 11:64856217-64856239 CTGCGTGGGAGGGGGCAGCTCGG - Intronic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1084014823 11:66371964-66371986 CTGCGGCGGAGGGGAAGGCGGGG + Intronic
1084102407 11:66958340-66958362 CAGCGGTAGAGGCGGCGGCGAGG - Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084165302 11:67372613-67372635 CCGCGGCGGGGGCGGGGGCGGGG + Intronic
1084546751 11:69818611-69818633 CCGCGGGGGAGGCGGCGCCGGGG - Intronic
1085208045 11:74748935-74748957 CTGAGTCGGCGGGGCCGGCGGGG + Exonic
1085332959 11:75668223-75668245 CGGCGGCGGTGGCTGCGGCGGGG + Exonic
1086341782 11:85854962-85854984 CTGCTACCAAGGCGGCGGCGCGG + Intergenic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1089543674 11:119206305-119206327 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090173205 11:124623109-124623131 CTGCAGCGGAGCCCGCGGCGAGG - Exonic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091558577 12:1594153-1594175 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1092335416 12:7628724-7628746 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335432 12:7628766-7628788 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1094375393 12:29783715-29783737 CTCTGCCCGAGGCGGCGGCGGGG - Exonic
1095752684 12:45729287-45729309 TTTCGGCGGCGGCGGCGGCGGGG - Intergenic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097107700 12:56635034-56635056 CTGGGCCGGCGGCGGCGGAGGGG + Intronic
1097269466 12:57765365-57765387 CGGCGTCTGAGGCGCCAGCGGGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098105963 12:67069314-67069336 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1098369134 12:69738841-69738863 CTGCGCCGGAAGCGGGGCCGGGG - Intronic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1100490459 12:95073327-95073349 CCGCGTCGGGGGCGGGGGCCAGG - Intronic
1100632295 12:96400598-96400620 CGGCGGCGGAGGCGGGGGCGGGG + Intergenic
1101592900 12:106139199-106139221 CGGCGGCGGCGGCGGCGGCCAGG + Exonic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102277960 12:111598123-111598145 TCGTGTCCGAGGCGGCGGCGGGG - Intronic
1102371018 12:112382324-112382346 CGGCGGCGGCGGCGGCGGCAGGG - Intronic
1102636220 12:114326612-114326634 CTGTGGCGGGGGCGGGGGCGGGG - Intergenic
1103377716 12:120469643-120469665 CTGAGGCGGCGGCGGCGACGTGG - Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103779403 12:123389122-123389144 CGGCGCTGGTGGCGGCGGCGAGG + Intronic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1103872185 12:124099862-124099884 CTGCGACGGTGGCGGGGGCTTGG + Intronic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104980172 12:132570127-132570149 CTGCGGGGGTGGCGGCTGCGGGG - Exonic
1105389049 13:19958703-19958725 AGGCGGAGGAGGCGGCGGCGCGG - Exonic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1106057710 13:26254264-26254286 CTGCGGCGGGAGCGGCGGGGCGG - Exonic
1106323730 13:28667279-28667301 CGGCGTGGGAGGCTGAGGCGGGG + Intronic
1107548962 13:41457734-41457756 CTGCGGCCGCGGCGGCCGCGGGG - Exonic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1107851473 13:44576733-44576755 CTGCGAGCGGGGCGGCGGCGAGG + Intronic
1108685426 13:52815334-52815356 CTGCCCAGGAGCCGGCGGCGGGG + Intergenic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1112091798 13:96090812-96090834 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1112271904 13:97976481-97976503 CGGCGCCGGCGGCCGCGGCGGGG + Intronic
1112328277 13:98458545-98458567 CCGCCTCGGGGCCGGCGGCGTGG - Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112507851 13:99985565-99985587 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1112580862 13:100675106-100675128 CTGAGGCGGAGGCGGGGCCGGGG + Intergenic
1113200736 13:107866164-107866186 CGGCGGCGGCGGCGGCGGCAAGG - Exonic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113655920 13:112067745-112067767 CGGCGGCGGGGGCGGAGGCGGGG + Exonic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1113655998 13:112068090-112068112 CGGCGCGGGTGGCGGCGGCGCGG + Exonic
1114634179 14:24178115-24178137 CGGCGACGACGGCGGCGGCGAGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115474562 14:33800593-33800615 CGGCGGCGGGGGCGGGGGCGGGG + Exonic
1115474566 14:33800605-33800627 CGGGGGCGGGGGCGGCGGCGCGG + Exonic
1115556898 14:34551190-34551212 CTGTCTCGGAGGGGGAGGCGGGG - Intergenic
1115752136 14:36504275-36504297 CGGCGACTGAGGAGGCGGCGTGG - Intronic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115761311 14:36581057-36581079 CGGCGGCGGCGGCGGTGGCGAGG - Exonic
1115771393 14:36666529-36666551 CCGCGTGCGGGGCGGCGGCGGGG - Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116928618 14:50668076-50668098 CGGCGGCGGAGGCGGCGGCTCGG - Exonic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118607674 14:67515339-67515361 CGGCGTCCGCCGCGGCGGCGCGG + Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119808729 14:77499107-77499129 CTGCGACGGCGACAGCGGCGGGG - Intergenic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1121137233 14:91510015-91510037 CTGAGGAGGCGGCGGCGGCGCGG - Exonic
1121417509 14:93789097-93789119 CGGCGCTGGCGGCGGCGGCGGGG - Intergenic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122672944 14:103385807-103385829 CTGCCTCGGCGGCCGAGGCGAGG - Exonic
1122863244 14:104591882-104591904 CTGGGGCGGGGGCGGAGGCGGGG - Intronic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1123684351 15:22786685-22786707 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1123739867 15:23226150-23226172 CTGGGTCGGGGACGGGGGCGGGG - Intergenic
1123898071 15:24848243-24848265 CGGCGGCGGGGGCGGGGGCGGGG + Intronic
1124246303 15:28073301-28073323 CTGCTTGGGAGGCTGAGGCGAGG + Intronic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124640028 15:31391605-31391627 AAGCGTCGGGGGCGGGGGCGGGG - Intronic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125200739 15:37099023-37099045 CTGCGTAGGAGCCGCCGCCGGGG - Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125516451 15:40323796-40323818 CTGTGGCTGTGGCGGCGGCGGGG + Intergenic
1125516613 15:40324318-40324340 CTTCGGGGGCGGCGGCGGCGGGG + Intergenic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125677578 15:41511200-41511222 CGGCTTCGGGGGCGGCGGCGGGG - Exonic
1125950387 15:43746599-43746621 GCACGTCGGAGGCAGCGGCGAGG - Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126109507 15:45167307-45167329 CGGCGCCGGAGGCGCGGGCGCGG + Exonic
1126725078 15:51623112-51623134 CTGGGGCGGAGGTGGGGGCGGGG + Intergenic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127165776 15:56243817-56243839 CGGCGGCCGCGGCGGCGGCGGGG - Intergenic
1127753439 15:62068015-62068037 CTACGGCGGCGGCGGCGGCCCGG + Exonic
1127763622 15:62164576-62164598 CTGCGGCGGCGGCGGAGGCCCGG - Exonic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128150019 15:65356958-65356980 CTACTTCGGAGGCGGAGGCAAGG - Intronic
1128322518 15:66703342-66703364 CGGCGGCGGTGGCGGCGACGAGG + Exonic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129262140 15:74374409-74374431 CTGCGGTGGAGGGGGCGGGGCGG + Intergenic
1129761577 15:78131741-78131763 CTGGGGCGGGGGCGGCAGCGAGG + Intronic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130656435 15:85794779-85794801 CTGAGGCGGCGGCGGCGGCGGGG - Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131200103 15:90388578-90388600 CGGGGTCCGAGGCGGCGGAGAGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131466086 15:92655748-92655770 CTGCGGCGGAGGCGGCTGCGCGG + Exonic
1131693881 15:94855573-94855595 CTGAGGCGGCGGCGGCGGCGAGG + Intergenic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132133516 15:99308559-99308581 CTGCTTCGGAGGCTGAGGTGGGG + Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132641879 16:981786-981808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1132779411 16:1614449-1614471 CAGGGCCGGGGGCGGCGGCGTGG + Intronic
1132942238 16:2514042-2514064 CGGTGGCGGAGGCGGGGGCGAGG - Exonic
1133156451 16:3880136-3880158 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133784576 16:8964072-8964094 CTGCGGCGCAGGCGGTGCCGGGG - Intronic
1134149873 16:11797189-11797211 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135517669 16:23149156-23149178 CCGCGCTGGCGGCGGCGGCGCGG - Exonic
1135597461 16:23755127-23755149 CCGCGTCGGCGGCTGCGGAGGGG + Intronic
1135691319 16:24539913-24539935 CCGAGGCGGCGGCGGCGGCGGGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1137426572 16:48385377-48385399 CGGCGGCGGCGGCGGCGGCCAGG - Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138105714 16:54286224-54286246 CGGCGGCGAGGGCGGCGGCGAGG + Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138450773 16:57092561-57092583 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1138561335 16:57802450-57802472 CCGAGGAGGAGGCGGCGGCGTGG - Exonic
1138654848 16:58485350-58485372 CTGTGACGGAGGTGGTGGCGGGG - Intronic
1139451167 16:67029123-67029145 CGGCGGCGGCGGCGGCGGCCGGG + Intronic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141079183 16:81035881-81035903 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831168 16:86510620-86510642 CGGCGGCGGGGGAGGCGGCGCGG + Exonic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142752635 17:1998033-1998055 CTGGGGCGGAGGCGGGGGTGGGG - Intronic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143781775 17:9232994-9233016 CTGCCTCGGAGACAGCGGCCAGG - Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1144930919 17:18858217-18858239 CTGCAGCTGAGGCTGCGGCGGGG + Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145928000 17:28662218-28662240 CGGCGGCGGTGGCGGCGGAGGGG + Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146219836 17:31008724-31008746 CAGCGGCGGAGGCGGCGGGCAGG - Intergenic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146393608 17:32444481-32444503 CGGCGTCGGCGGCCGCGGCCGGG + Exonic
1147393183 17:40122366-40122388 CGGCAGCAGAGGCGGCGGCGAGG + Intronic
1147556999 17:41486004-41486026 CTGAGTGGGAGGCGGTGGCAGGG - Intergenic
1147577796 17:41612613-41612635 CGGCATCGGAGGCGGCATCGGGG - Exonic
1147653024 17:42072717-42072739 CTGGGCCGGCGGGGGCGGCGCGG - Intergenic
1147672392 17:42184177-42184199 GCGCGACGGAGGCGGCGGCCGGG + Exonic
1147720440 17:42536467-42536489 CAGCCTGGGCGGCGGCGGCGCGG + Exonic
1147793080 17:43025281-43025303 GGGCGGGGGAGGCGGCGGCGGGG + Exonic
1147971174 17:44219742-44219764 CTGAGGCTGCGGCGGCGGCGGGG - Intronic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148356472 17:46978941-46978963 CGGCGTGGGCGGCGGCGCCGGGG - Exonic
1149610527 17:57955323-57955345 CAGGCTCGGCGGCGGCGGCGCGG + Exonic
1149712572 17:58756335-58756357 CTGGGGCGGCGGCGGCGGCACGG - Exonic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150128243 17:62652654-62652676 CTGGGCGGGAGGCGGCGGAGCGG + Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150561923 17:66302329-66302351 CGGCGGCGGCGGCGGCGGCCGGG - Intergenic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1150791893 17:68205760-68205782 CTTGGGCGGCGGCGGCGGCGGGG - Intergenic
1151565084 17:74893278-74893300 GTGCGGCGGAGGTGGCGGCGCGG - Intronic
1152049183 17:77959081-77959103 CGGCGGCTGCGGCGGCGGCGCGG - Intergenic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152876316 17:82788383-82788405 ATGGCTGGGAGGCGGCGGCGGGG + Intronic
1152919799 17:83060519-83060541 CCGTGTCAGAGGCGGCCGCGTGG + Intergenic
1152924486 17:83080866-83080888 CCGCGGCGGGGGCGGGGGCGGGG - Intronic
1152970685 18:158592-158614 CGGCGGCCGAGGCGGAGGCGCGG - Exonic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1155467223 18:26150446-26150468 CTACTTGGGAGGCTGCGGCGGGG - Intronic
1157383927 18:47247057-47247079 CTGGGCCAGAGGGGGCGGCGGGG + Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384298 18:47248308-47248330 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1157849137 18:51030715-51030737 CGGCGGCGGCGGCGGCGGCTGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1157867202 18:51197234-51197256 CGGTGGCGGCGGCGGCGGCGGGG + Exonic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158435996 18:57435833-57435855 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158601938 18:58863501-58863523 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1158658085 18:59359145-59359167 CTTCGTCCGGGGCGACGGCGTGG - Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1159798107 18:72867788-72867810 CGGCGCCGGCGGCGGCGGGGTGG + Exonic
1160680328 19:409175-409197 ATACGGCGGCGGCGGCGGCGGGG - Intergenic
1160735935 19:662502-662524 CTGCCTCCAAGGCGGCGGCCAGG + Intronic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160769109 19:822284-822306 CGGGGGCGGAGGCGGGGGCGGGG + Intergenic
1160830414 19:1102096-1102118 CTGAGTCGGGGGCAGTGGCGGGG + Intergenic
1160836772 19:1128288-1128310 CTGTGCCGGAGGCAGGGGCGGGG + Intronic
1160930465 19:1567639-1567661 CCGGGGCGGCGGCGGCGGCGGGG + Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930703 19:1568310-1568332 CCGAGGCGGCGGCGGCGGCGCGG + Intergenic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1161364301 19:3869190-3869212 CTGCGTAGGAGGCGGGGCCTCGG - Intergenic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161460170 19:4391864-4391886 CGGCATTGGAGCCGGCGGCGTGG - Intronic
1162033206 19:7926052-7926074 CGGCGGCGGCGGCGGCGGCCCGG + Exonic
1162100215 19:8334651-8334673 CTGCGGAGGAGGCAGCGGCGGGG - Exonic
1162372929 19:10289865-10289887 CGGCGGCAGAGGCGGCGGGGGGG - Intergenic
1162470875 19:10871493-10871515 CGGTGGCGGCGGCGGCGGCGAGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162934156 19:13972865-13972887 CGGCGGGGGAGGCGGTGGCGGGG - Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163138809 19:15332498-15332520 CGGCGGCGGCGGCGGCGGCTGGG - Intronic
1163320477 19:16571907-16571929 CGGCCTCGGGGGCGGCGGCCGGG - Intronic
1163424880 19:17235862-17235884 CTTCGGCGCAGGGGGCGGCGCGG - Exonic
1163441292 19:17323805-17323827 CGGCATTGGCGGCGGCGGCGCGG + Exonic
1163787964 19:19286635-19286657 CTGCTTGGGAGGCTGAGGCGGGG + Intronic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1165408243 19:35643395-35643417 CGCCTTCGGAGCCGGCGGCGGGG - Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165803139 19:38565200-38565222 CGGCGGCGGGGGCGACGGCGCGG + Exonic
1166143584 19:40819335-40819357 CTGCTTGGGAGGCTGAGGCGAGG + Intronic
1166183966 19:41127444-41127466 CTGCTTGGGAGGCTGAGGCGAGG - Intronic
1166361247 19:42253856-42253878 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1166949436 19:46416655-46416677 GTGGGGCGGAGGCGGAGGCGAGG + Intergenic
1167040608 19:47020786-47020808 GCGCGGGGGAGGCGGCGGCGGGG + Intronic
1167268253 19:48493889-48493911 CGGCGCCGGGCGCGGCGGCGGGG - Exonic
1167368088 19:49065073-49065095 CCGGGTCGGGGGCGGGGGCGGGG + Intronic
1167455721 19:49595988-49596010 CTCCCTGGGAGGCGGCGGTGAGG + Exonic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167648231 19:50717117-50717139 CAGCGTGGGAGGAGGCGGCAGGG - Intronic
1168072804 19:53962236-53962258 CTGGGGAGGAGGCGGCGGCGTGG + Intergenic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168339125 19:55613809-55613831 CTGCGGCGGGGGCTGCGGCGGGG - Exonic
925628704 2:5867285-5867307 CTGCGTGGGAGGCAGCGAGGAGG + Intergenic
926089887 2:10043218-10043240 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926089897 2:10043236-10043258 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926131356 2:10304678-10304700 CTGCGTCCGAGCCAGCGCCGAGG - Intronic
926717926 2:15939722-15939744 CTGCGGAGGAGGAGGCGGCCTGG - Intergenic
927472218 2:23385245-23385267 CGGGGACGGCGGCGGCGGCGCGG - Exonic
927652478 2:24920592-24920614 CGGCGGAGGAGGGGGCGGCGGGG - Intergenic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
929174230 2:38960549-38960571 CGGCGACGGCGGCGGCGGCCGGG - Exonic
929570797 2:43021864-43021886 CTGGATGGCAGGCGGCGGCGGGG - Intergenic
930011421 2:46941034-46941056 CCGCGGCGGGGGCGGCGGCGGGG + Intronic
930136110 2:47905619-47905641 CTGCGGCGGCGGCTGCTGCGGGG + Exonic
930529430 2:52571921-52571943 CTGCTGCAGAGGCGGCGCCGAGG - Intergenic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
931649515 2:64454899-64454921 GTACGTCGGGGGCGGTGGCGGGG - Intronic
933666715 2:84970837-84970859 CGGCGGCGGCGGCGGCGGCCAGG + Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933908291 2:86914936-86914958 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934567134 2:95347141-95347163 CTGCGGCGGAGGCGGCGAAGGGG - Intronic
935592159 2:104853839-104853861 ATGTGGCGGAGGGGGCGGCGGGG + Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592897 2:104857084-104857106 CGGCGGCGGCGGCGGCGGCAGGG - Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936412880 2:112275936-112275958 CTGCGAGGCCGGCGGCGGCGGGG - Exonic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937221599 2:120345655-120345677 CTGCGGCGGGCGCTGCGGCGGGG - Intergenic
937301888 2:120847743-120847765 CTGCGTGGGGGGCAGGGGCGGGG + Intronic
938018397 2:127885998-127886020 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
938397860 2:130963983-130964005 CTGGGCCGGGGGCGGCGGTGCGG - Intronic
938449426 2:131403890-131403912 CTGCGGTGGGGGAGGCGGCGGGG - Intergenic
938451542 2:131425324-131425346 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
938883970 2:135624282-135624304 CTGCGTGGGAGGCTGAGGCAGGG + Intronic
939432660 2:142130786-142130808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
945241553 2:207681459-207681481 CCGCGGCGAGGGCGGCGGCGGGG - Intergenic
945466006 2:210171292-210171314 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
946395468 2:219441971-219441993 CGGAGTCGGAGGCGGGGCCGGGG - Intronic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946843246 2:223837790-223837812 CTGCAGCCGAGGCGGGGGCGGGG - Intronic
946921437 2:224585182-224585204 CGGCGGCGGCGGCGGCGGCTCGG + Exonic
947506657 2:230713050-230713072 CCGCGGCGGCGGCGGCTGCGCGG - Exonic
947723248 2:232381687-232381709 CGGCGTCGGTGGTGCCGGCGGGG - Exonic
947727594 2:232409764-232409786 CGGCGTCGGTGGTGCCGGCGCGG - Exonic
947860525 2:233354553-233354575 CGGCGGCGGAGGCGGTTGCGGGG - Exonic
948216652 2:236237588-236237610 CTGGGACGGAGGCGGAGGCGGGG + Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948926591 2:241102496-241102518 CCGCGGCAGAGGCGGCGGCACGG - Intergenic
1168831024 20:845317-845339 CTGGGCTGGAGGCGGCGGCAGGG - Exonic
1168883252 20:1225636-1225658 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1169849550 20:10034878-10034900 CGGAGGCGGAGGCGGGGGCGGGG + Intronic
1169914920 20:10674524-10674546 TGGCGGCAGAGGCGGCGGCGAGG + Intergenic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172083220 20:32358681-32358703 CTGGGGCGGCGGCGGCGGTGGGG - Exonic
1172284724 20:33732350-33732372 CTGCGCGGGAGGCGACGGCGGGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172596592 20:36154710-36154732 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1173246404 20:41340736-41340758 TGGCCTCGGAGGCGGGGGCGGGG - Intergenic
1173704255 20:45098505-45098527 CGGCGTCGGAGGAGCAGGCGCGG - Exonic
1173843677 20:46174874-46174896 CGGCGACGGGGGCGGCAGCGCGG - Exonic
1174317524 20:49713915-49713937 CAGCGGCGGGGGCGGAGGCGGGG + Intergenic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174607095 20:51768662-51768684 CTGCAGCGGTCGCGGCGGCGCGG - Intergenic
1174804675 20:53594442-53594464 CGGAGGCGGAGTCGGCGGCGGGG - Intronic
1175429372 20:58891237-58891259 CCGCGGCGGCGGCGGCGGCTGGG - Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175715516 20:61252449-61252471 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1176016798 20:62938111-62938133 CCGCGGCGGAGGCGGGGGCGGGG - Exonic
1176157031 20:63627063-63627085 ATTCGGCGGCGGCGGCGGCGCGG + Intergenic
1176283385 20:64327999-64328021 CTGCGCCTGGGGTGGCGGCGGGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176952661 21:15064943-15064965 CGGCGGAGGAGGCGGCGGCGAGG - Exonic
1178865096 21:36320404-36320426 CGGCGGCGGGGGCTGCGGCGGGG + Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1180101814 21:45590969-45590991 CTGCGGGAGAGGCGGAGGCGGGG + Intergenic
1180159906 21:45994367-45994389 CTGCGTGGGAGCCGGCTGCAGGG + Intronic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180965263 22:19784808-19784830 CTGCACCGGAGGCAGCGGCTGGG + Exonic
1181331924 22:22099339-22099361 CTGCGTCAGAGACTGGGGCGAGG - Intergenic
1181478025 22:23180573-23180595 CGGCGGCGGCGGCGGCGGCACGG + Exonic
1182576474 22:31276574-31276596 CCGCGGCGAGGGCGGCGGCGGGG - Intronic
1182729371 22:32474942-32474964 CGGCGACGGGGACGGCGGCGGGG - Exonic
1183247219 22:36703246-36703268 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183524929 22:38317279-38317301 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1183605913 22:38866637-38866659 GGGCGTCGTAGGGGGCGGCGGGG + Exonic
1184562106 22:45269257-45269279 CGGAGGCGGAGGCGGGGGCGGGG + Intergenic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG + Intronic
1185055360 22:48576110-48576132 CGGCTCCGGGGGCGGCGGCGGGG + Intronic
1185409384 22:50674297-50674319 CTGCGCCGGAGGCGGGGGCCGGG - Intergenic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203253479 22_KI270733v1_random:128535-128557 CCGCGGCGTCGGCGGCGGCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
951080464 3:18445285-18445307 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
951907803 3:27721610-27721632 CAGCGGCGGGGGCGGCGGCCCGG - Exonic
953773477 3:45796527-45796549 CTGCGTCGGCGGCGGAGGCGCGG - Exonic
953908875 3:46882163-46882185 CCGCGTCGGCGGCTGCGGAGGGG + Intronic
953947779 3:47164026-47164048 CGGCGGCGGCGGCGGCGGCAGGG + Intergenic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954615555 3:51967344-51967366 CGGCGGCGGCGGCGGCGGCACGG + Exonic
955769235 3:62372520-62372542 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956064157 3:65379372-65379394 CGGCGGCGGGGGCAGCGGCGTGG - Exonic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
959056656 3:101574190-101574212 CTGCAGGGGAGGCCGCGGCGGGG + Exonic
960896714 3:122514237-122514259 CCGGGTCGGAGCCGGCGGCCCGG - Intronic
961081799 3:124033854-124033876 CTGCCTCGGACGCGGCGTCTCGG + Intergenic
961377435 3:126476062-126476084 GGGCGCCGGAGGCGGAGGCGGGG + Intergenic
961377440 3:126476068-126476090 CGGAGGCGGAGGCGGGGGCGGGG + Intergenic
961378604 3:126482890-126482912 CTGTGTGGAAGGCGGAGGCGGGG - Intronic
961827160 3:129605271-129605293 CGGCGGCGGGGGCGGGGGCGGGG - Intronic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962129849 3:132660627-132660649 CGGCGACGGAGGGGGCGGCCGGG + Exonic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962808923 3:138945856-138945878 GTGCGGCGGAGGCGGGGGTGCGG + Exonic
963236727 3:142963620-142963642 CTGCGGCAGCGGCGGCGGCGCGG + Exonic
963252991 3:143119656-143119678 CGGCGTTGGGGGCGGGGGCGGGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
965560977 3:170062266-170062288 GTGCGGCGGAGGCAGCAGCGGGG + Intronic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966866519 3:184261473-184261495 CGGCGGCGGCGGCGGTGGCGGGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967916720 3:194583896-194583918 CGGCGGCGGCTGCGGCGGCGGGG + Intergenic
968131238 3:196194045-196194067 CTGAGTGGGAGGCAGCGGAGGGG + Intergenic
968213402 3:196868026-196868048 CCGCGACGGGGCCGGCGGCGGGG + Exonic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968775200 4:2536234-2536256 TTGCCTCGCGGGCGGCGGCGCGG + Intronic
968820183 4:2844065-2844087 CTGAGGCGGCGGCGGGGGCGCGG + Intronic
968850579 4:3075028-3075050 TGGCGGCGGGGGCGGCGGCGGGG - Exonic
969413311 4:7043342-7043364 CTGCGGCGGCGGTGGCGGCCGGG + Intronic
969436591 4:7192612-7192634 CGGCAGCGGAGCCGGCGGCGGGG - Exonic
970202891 4:13627516-13627538 CTGCGGCTGCGGCTGCGGCGGGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970333053 4:15003854-15003876 CTGGGTCGGCGGCGGCTGCTGGG - Exonic
970456221 4:16226550-16226572 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
970824190 4:20253149-20253171 CTGCGGCGGAGTCGAGGGCGAGG + Intergenic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971327451 4:25655848-25655870 CTGGGCTGGAGGCGGCGGCCAGG - Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
973279219 4:48341712-48341734 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
973292366 4:48483406-48483428 CGGCGTCGGGGGCGGCGGGCCGG - Exonic
973613592 4:52659007-52659029 CTGGGGCGGCGGGGGCGGCGGGG - Intronic
974047140 4:56907872-56907894 CGGTGGCGGCGGCGGCGGCGCGG + Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
976774825 4:88697257-88697279 CTGCGGCAGAGGCTGCCGCGGGG - Exonic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977257651 4:94758272-94758294 GTGGGGCGGTGGCGGCGGCGGGG + Intronic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
978072568 4:104491415-104491437 CGGCGGCGGAGGCGGGGGCGGGG - Exonic
978072572 4:104491421-104491443 CGGCGGCGGCGGCGGAGGCGGGG - Exonic
978072588 4:104491457-104491479 CGGGGGCGGGGGCGGCGGCGGGG - Exonic
979623969 4:122826580-122826602 GCGCGTCGGAGGCCGCGGCAGGG - Intergenic
982157401 4:152535796-152535818 CTGAGCCGGAGCCGGCGGCTTGG - Exonic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
984668066 4:182449093-182449115 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
988547653 5:32173771-32173793 CTGGGCGGGGGGCGGCGGCGCGG - Intronic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990376216 5:55173344-55173366 CTCGGCCGGAGGCGGTGGCGGGG - Intergenic
990545127 5:56815263-56815285 CGGGGGCGGAGGCGGAGGCGTGG - Intergenic
990825433 5:59893362-59893384 CGGCGGCGGGGGCGGCGGCAGGG + Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991371611 5:65925711-65925733 CTGCGGCGGGGGCGGGGGCGGGG - Intergenic
992067463 5:73120720-73120742 CTGCGCCGGCGGCGGCGGGTCGG + Intronic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992530143 5:77645318-77645340 CGGCGACGGCGGCGGCGGCGCGG - Intergenic
993457366 5:88141732-88141754 CGGGGGCGGAGGCGGGGGCGGGG - Intergenic
993500371 5:88660388-88660410 CTGGGTGGGGGGCGGGGGCGGGG - Intergenic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
994353876 5:98774024-98774046 CTCCGGCGAGGGCGGCGGCGCGG - Exonic
995106233 5:108381004-108381026 CGGCGGCGGCGGCGGTGGCGGGG - Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997976682 5:138445318-138445340 CTGGGTCGGAGGCGGCCGTCAGG - Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
999322613 5:150624744-150624766 CGGTGGCGGTGGCGGCGGCGAGG + Intronic
999723067 5:154412963-154412985 CTGCGTCCGAGGCCGTGGGGAGG + Exonic
1001065073 5:168529582-168529604 CCGAGGCGGCGGCGGCGGCGCGG + Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002784982 6:393431-393453 TCGCCTCGGAGGCGGCGCCGGGG - Intronic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003070406 6:2941018-2941040 CTGCGTGGGAGGCTGAGGTGGGG + Intergenic
1003175859 6:3751864-3751886 CTGCGGAGGCGGCGGGGGCGCGG - Exonic
1003869658 6:10391398-10391420 CTGCCTGGGAGGAGGCAGCGCGG - Intergenic
1004044868 6:12013089-12013111 CGGCGGCGGAGCAGGCGGCGAGG + Intronic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1005962390 6:30703449-30703471 GTCCGTCGGAGGCTGCGGCTTGG + Exonic
1006472663 6:34237336-34237358 CCGCGGCGGCGGCGGCGGAGGGG + Intronic
1007390238 6:41546500-41546522 CGGCGCAGGCGGCGGCGGCGCGG + Exonic
1007417816 6:41702327-41702349 CTGGGTCGGAGGGGGCGGAAGGG + Intronic
1007665295 6:43509940-43509962 CTGCGGCGGAGGCTGCGGCGGGG + Exonic
1007760132 6:44128353-44128375 CTGCGTTGGAGGGTGCGGTGGGG + Intronic
1007781400 6:44256970-44256992 CTGCAGCGGAGGGGGCGGGGAGG - Intronic
1007902046 6:45422031-45422053 CCGCCGCGGAGGCGGCGGCGCGG + Intronic
1008013328 6:46491204-46491226 CGGAGGCGGAGGCGGCGGCTGGG + Exonic
1008387741 6:50913279-50913301 CTGCGGCGGCGGTGGCTGCGTGG + Intergenic
1009431632 6:63572571-63572593 CGGCGATGCAGGCGGCGGCGGGG - Exonic
1009975710 6:70668314-70668336 GTCCGCCAGAGGCGGCGGCGAGG + Intronic
1011194007 6:84763998-84764020 CTGCAGCCGCGGCGGCGGCGCGG - Exonic
1011983851 6:93418685-93418707 CTGCGTCGGAGGCGGCGGCGCGG - Intronic
1012400005 6:98835086-98835108 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1013230510 6:108157782-108157804 CTGCGGCGGGGGCGGCCGGGCGG - Intronic
1013514913 6:110875990-110876012 CTGCTACGGAGCCGGCGGAGCGG + Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1015965589 6:138693082-138693104 CGGCGGCGGCCGCGGCGGCGAGG + Intergenic
1016714107 6:147204111-147204133 CGGCGACGGTGGCGGCGCCGGGG + Intergenic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017708613 6:157147281-157147303 CAGGGTCGGAGGCGGGGGTGAGG - Intronic
1017708626 6:157147313-157147335 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1017708650 6:157147377-157147399 CAGGGTCGGAGGCGGGGGTGAGG - Intronic
1017708662 6:157147409-157147431 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1017708685 6:157147473-157147495 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1017708708 6:157147537-157147559 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1017708731 6:157147601-157147623 CAGGGTCGGAGGCGGGGGTGGGG - Intronic
1017708760 6:157147665-157147687 CAGGGTCGGAGGCGGGGGTGAGG - Intronic
1017708773 6:157147697-157147719 CAGGGTCGGAGGCGGGGGTGAGG - Intronic
1017708786 6:157147729-157147751 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1017708849 6:157147889-157147911 CAGGGTCGGAGGCGGAGGTGAGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019279671 7:193409-193431 CGGCGGCGGAGGAGGCGGCCGGG - Exonic
1019298237 7:290226-290248 CTTCGTCGGAGCTGCCGGCGGGG - Intergenic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019343659 7:519744-519766 CTGCGGCGGAGGCGCCGACTCGG - Intronic
1019582061 7:1769596-1769618 CTGTGCCGGAGGCGGTGGTGTGG + Intergenic
1019828333 7:3301616-3301638 CGGTGGCGGCGGCGGCGGCGCGG + Exonic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1021101101 7:16586564-16586586 CTGCTGCGGTGGCGGCTGCGTGG + Intergenic
1021313150 7:19117060-19117082 CTGTGGCGGCGGCGGCGGCGCGG - Exonic
1021451051 7:20784421-20784443 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1024085428 7:45888525-45888547 CTGGGAGGGTGGCGGCGGCGCGG - Exonic
1025007521 7:55365944-55365966 CCTCGGAGGAGGCGGCGGCGGGG + Exonic
1026025563 7:66741150-66741172 CTGCTTCGGAGCCAGCGGCCTGG - Intronic
1027025865 7:74851337-74851359 CGGCGTCGGCGGCGGGGGCGGGG + Intronic
1027061894 7:75092773-75092795 CGGCGTCGGCGGCGGGGGCGGGG - Intronic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029730131 7:102433494-102433516 CTGCGGCGGCCGCGGGGGCGGGG + Intronic
1029896399 7:103989353-103989375 CGGCGGCGGCGGCGGCGGCATGG - Exonic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1032119318 7:129144956-129144978 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033477133 7:141702039-141702061 CTGGGGCCGGGGCGGCGGCGGGG - Exonic
1033657319 7:143382386-143382408 CTCCTCCGGAGGAGGCGGCGGGG - Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034455403 7:151167491-151167513 CAACGGCGGGGGCGGCGGCGGGG - Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035264967 7:157685378-157685400 CTGGTTCTGAGGGGGCGGCGGGG + Intronic
1036755152 8:11466667-11466689 CCGCGCAGGAGGAGGCGGCGGGG - Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037535149 8:19817109-19817131 CGGGGGCGGAGGCGGGGGCGGGG - Intergenic
1037768777 8:21787248-21787270 CTGTCTTGGAGGCGGCGGGGGGG + Intronic
1037819038 8:22126986-22127008 CTGCGTGGGAGGGGGCAGCCGGG - Intronic
1038304032 8:26383281-26383303 CCGCGCCGGTGGCGGCGGCCGGG - Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1041201645 8:55455263-55455285 CTGCGGCTGCGGCGGCGGCCCGG + Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1043847281 8:85177515-85177537 CGGCGGCGGGGGCGGCTGCGGGG - Exonic
1043982993 8:86662064-86662086 CTGAGTTGGCGGCGGCGGCACGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047024555 8:120811811-120811833 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1047292287 8:123541109-123541131 CCGCGACGGGGGCGGCGGGGCGG + Exonic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049694577 8:143977076-143977098 CTGCTTCCGAGGAGGCGTCGGGG - Intergenic
1049746960 8:144267086-144267108 AGGCGGCGGGGGCGGCGGCGGGG - Exonic
1049761469 8:144333769-144333791 CGACGCCGGAGGCGGGGGCGGGG - Exonic
1051079693 9:13279662-13279684 CTGCCGCGGAGGCGGTGGCGGGG + Intergenic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052888939 9:33677382-33677404 CGGCGGCGGCGGCGGCGGCCCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054407655 9:64774848-64774870 CGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1054842667 9:69760054-69760076 CGGCGGCGGCCGCGGCGGCGGGG - Intergenic
1055030577 9:71768749-71768771 CAGGGGAGGAGGCGGCGGCGCGG + Exonic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055611779 9:78031585-78031607 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
1056154051 9:83817560-83817582 CCGCGGGAGAGGCGGCGGCGGGG - Exonic
1056356446 9:85805533-85805555 CCGCGGGAGAGGCGGCGGCGGGG + Intergenic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1056921180 9:90790542-90790564 CTACGTGGGAGGCTGAGGCGGGG - Intergenic
1057234268 9:93346337-93346359 CTAGGGCGGAGGCGGAGGCGGGG - Exonic
1057245475 9:93451518-93451540 CGGCGGCGGAGGCGGAGGCCCGG - Intronic
1057463753 9:95292348-95292370 CGGAGGCGGTGGCGGCGGCGGGG + Intronic
1057872511 9:98728966-98728988 CTGCGGCTGAGGCGGGGGAGCGG + Intergenic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060114440 9:120929113-120929135 CGGTGGCGGAGGCGGCGCCGAGG - Intronic
1060555278 9:124504741-124504763 CCTCGCCGGCGGCGGCGGCGCGG - Intronic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1060829866 9:126706473-126706495 CTGCGCCAGAGGCGGCATCGAGG + Intergenic
1060849196 9:126860686-126860708 CGGCGGCGGAGGGGGCGCCGCGG + Intronic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061438152 9:130579652-130579674 CGGCGGCGGCGACGGCGGCGGGG + Exonic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061908199 9:133709403-133709425 GTGCGTGGGAGGCGGCTGCAGGG - Intronic
1062444503 9:136587968-136587990 TTGCGGGGGAGGCGGGGGCGGGG + Intergenic
1062499672 9:136846984-136847006 CCGCGCCGGGGGCGGCCGCGCGG - Exonic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062592656 9:137281119-137281141 CTGCAGCGGGGCCGGCGGCGGGG - Exonic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1185641510 X:1591634-1591656 CGGCGTCGGAGGCGCCTCCGGGG + Exonic
1185736584 X:2500742-2500764 CTGGCTCGGGGGCGGGGGCGCGG - Intronic
1185892790 X:3835581-3835603 CCGCGGCGGATGCGGCGGCCAGG - Intronic
1185897898 X:3874001-3874023 CCGCGGCGGATGCGGCGGCCAGG - Intergenic
1185903017 X:3912432-3912454 CCGCGGCGGATGCGGCGGCCAGG - Intergenic
1187173016 X:16870074-16870096 AGGAGTCCGAGGCGGCGGCGAGG - Intronic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188537262 X:31211223-31211245 CTGCGTGGGAGGCTGGAGCGAGG + Intronic
1189322407 X:40094840-40094862 CTGTGTGGGAGGCGGAGGCCAGG + Intronic
1189323261 X:40098419-40098441 CTTGGGCGGCGGCGGCGGCGAGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1190598384 X:52067563-52067585 CACGGTTGGAGGCGGCGGCGCGG + Exonic
1190610440 X:52186510-52186532 CACGGTTGGAGGCGGCGGCGCGG - Exonic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192361761 X:70445135-70445157 TGGCGGCGGTGGCGGCGGCGTGG + Exonic
1193819917 X:86148779-86148801 CAGTGCCGGAGGCGGCGGCAGGG + Exonic
1196707339 X:118727683-118727705 CTGCGCCGGCGGCGGGGGCGGGG + Exonic
1196707344 X:118727689-118727711 CGGCGGCGGGGGCGGGGGCGGGG + Exonic
1196791409 X:119468369-119468391 AGGCGTCGGAGGCGGGGCCGGGG - Intergenic
1197415263 X:126165963-126165985 CGGCGGCGGCGGCGGCGGCCCGG + Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198767096 X:140091345-140091367 CGGCGGCGGCGGCGGCGGCTGGG + Intergenic
1199445121 X:147912093-147912115 CGGCGGCGGCGGCGGCGGCTGGG + Exonic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic