ID: 1011984033

View in Genome Browser
Species Human (GRCh38)
Location 6:93419618-93419640
Sequence GCTGAGAGCCTCCGCCACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011984022_1011984033 17 Left 1011984022 6:93419578-93419600 CCAATAATATCAATTAGGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1011984033 6:93419618-93419640 GCTGAGAGCCTCCGCCACTCGGG 0: 1
1: 0
2: 1
3: 9
4: 126
1011984016_1011984033 24 Left 1011984016 6:93419571-93419593 CCACACTCCAATAATATCAATTA 0: 1
1: 0
2: 1
3: 13
4: 252
Right 1011984033 6:93419618-93419640 GCTGAGAGCCTCCGCCACTCGGG 0: 1
1: 0
2: 1
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011984033 Original CRISPR GCTGAGAGCCTCCGCCACTC GGG Intergenic
901063334 1:6483911-6483933 GCTGGGAGCCTCTGCCATGCTGG - Intronic
901493322 1:9607617-9607639 CTGGAGAGCCTCCGACACTCGGG - Exonic
902193478 1:14780357-14780379 GTTGAGTGTCTCCTCCACTCTGG + Intronic
904401243 1:30258043-30258065 GCTCTGAGCCTCCGCCCCTGTGG - Intergenic
909034390 1:70580848-70580870 GCTGAGGGCCTCCTCCACAGTGG - Intergenic
910360356 1:86409676-86409698 GCTGAGGGCCTCCTCCAGGCAGG + Intergenic
911620280 1:100059232-100059254 GCTGAGAACCTCTGCCTCCCAGG + Intronic
915557984 1:156670601-156670623 GCTGAGACCCTGGGCCACACTGG - Exonic
918274696 1:182942450-182942472 GCCGAGAGCCTCCGCGAAACTGG + Intronic
920185170 1:204154998-204155020 GCTGAGGCCCTCTGCCACCCAGG - Exonic
924198985 1:241640272-241640294 GCTGAGCGCCTCCGCCCGCCAGG - Exonic
1063426347 10:5953045-5953067 GCAGAGAGGCTCCTTCACTCCGG + Exonic
1067369760 10:45672548-45672570 GCCGAGCGCCCGCGCCACTCCGG + Intronic
1067409514 10:46052273-46052295 GCTGTGAGCCACAGCTACTCTGG + Intergenic
1068673131 10:59743906-59743928 TCTGCCAGCCTCCGCCTCTCAGG + Intergenic
1068953790 10:62804449-62804471 GCCAAGAGCCTCCACTACTCCGG + Intergenic
1069592767 10:69652284-69652306 GCCTGGAGCCTCCGCCGCTCTGG + Intergenic
1071502747 10:86215178-86215200 GCTGGGAGCCCCAGCCTCTCTGG + Intronic
1072275923 10:93823216-93823238 GCCTAGAGTCTCAGCCACTCAGG + Intergenic
1072566086 10:96617850-96617872 GCTGTGAGCCTGGGGCACTCAGG + Intronic
1072623405 10:97095785-97095807 GGTGCGACCCTCTGCCACTCTGG + Intronic
1073453502 10:103623082-103623104 GCTGAGAGCTCTCGCCATTCTGG + Intronic
1076911793 10:133394123-133394145 GCTGCGGGCCTCCGGCACTGCGG - Intronic
1077212280 11:1376944-1376966 GCTTATAGCCTCAGCTACTCAGG + Intergenic
1085772355 11:79336922-79336944 GCTGAGACCCAGCCCCACTCAGG + Intronic
1087022151 11:93614536-93614558 GGGGATAGCCTCCGCCACTAAGG + Intergenic
1087972688 11:104504384-104504406 GATGAGAGCCTCTACCAATCAGG - Intergenic
1089699964 11:120238707-120238729 GCTTATAGTCTCAGCCACTCAGG + Intronic
1091555036 12:1566671-1566693 GCTCTGCGCCTCCGGCACTCTGG - Exonic
1092376675 12:7961489-7961511 GCTTATAGTCTCCGCTACTCAGG - Intergenic
1093638759 12:21501621-21501643 GCTGAGAGCATCCACCCTTCCGG + Intronic
1094624123 12:32106797-32106819 GCTCGGAGCCGCCGCCACGCGGG + Intergenic
1096502144 12:52070529-52070551 GCTGTTAGCCTCTGCCACTCGGG + Intronic
1100325834 12:93539149-93539171 GCTGGGAGCATCATCCACTCGGG - Intergenic
1102253765 12:111405048-111405070 GCTGAGAGCATGTCCCACTCCGG + Intergenic
1104015056 12:124956611-124956633 GCTGAGAGTCCCAGCTACTCAGG - Intronic
1104316039 12:127702496-127702518 CCTGTGAGCCTCCTCCATTCCGG - Intergenic
1104334617 12:127881761-127881783 GGTGAGAGCCACAGCCACTGAGG - Intergenic
1105038918 12:132946722-132946744 GCTGTGAGCTGCCCCCACTCTGG - Intronic
1106292526 13:28378171-28378193 GCTGATAGCCCCAGCTACTCAGG - Intronic
1107177829 13:37420194-37420216 GCTGACAACCTCCGCCTCCCAGG - Intergenic
1109622333 13:64925922-64925944 GCTCGGAGCTTCCGCCACTCTGG - Intergenic
1117315179 14:54566244-54566266 GCTGAGAGCCGCCGCGGCCCCGG + Intergenic
1122919753 14:104875143-104875165 GGTGAGAGCCTGGGCCCCTCAGG - Intronic
1124614837 15:31234124-31234146 GGTGAGGGCCTCTGCCTCTCAGG + Intergenic
1128512135 15:68319785-68319807 GCTGAGAACCACCGGCACTAGGG - Intronic
1128516317 15:68344172-68344194 GCTGAGGTCCTCTGCCACGCTGG - Intronic
1130738377 15:86572599-86572621 GCCCAGAGCCTCCGCAGCTCTGG - Intronic
1130766245 15:86874472-86874494 GTTGAGAGCCTCACCCACTCTGG + Intronic
1132464358 16:70996-71018 TGTGAGGGCCTCCGCCACACCGG - Intronic
1132548886 16:546109-546131 GCTCAGAGCCCTCGCCACGCGGG + Intronic
1137581651 16:49637287-49637309 GCTGAGAGCCGCTGCCGCTTCGG + Exonic
1139341435 16:66270427-66270449 GCTGAGATCCGCTGCCCCTCTGG - Intergenic
1140704810 16:77617723-77617745 GCTGAGAGCCTCCTCCACTGAGG - Intergenic
1141695170 16:85615677-85615699 GCTCAGAGCCTGCGCCACAGTGG - Intronic
1142664826 17:1456428-1456450 GCTGCGAGGCCCCGCCCCTCGGG - Intronic
1147567088 17:41544403-41544425 GCTCACAGCCTCAGCCTCTCTGG + Intergenic
1150624359 17:66832157-66832179 ACTGGGAGCCTCTCCCACTCTGG + Intergenic
1150648391 17:66994049-66994071 GCTGTGAGCCACCGCACCTCTGG - Intronic
1154945196 18:21156284-21156306 TCAGAGAGTCTCCTCCACTCAGG + Intergenic
1154945842 18:21160553-21160575 TCAGAGAGTCTCCTCCACTCAGG + Intergenic
1156327152 18:36085145-36085167 GCCCAGAGGCTCTGCCACTCTGG + Intergenic
1157321772 18:46640145-46640167 GCAGTGAGCCTCTCCCACTCTGG + Intronic
1158023563 18:52870228-52870250 GCCTGGAGCCTCCACCACTCCGG - Intronic
1158792205 18:60794964-60794986 GCTGAGAGCCTCTGCGAAGCTGG + Intergenic
1160685741 19:435910-435932 GCTGACAGCCTCAGGCACACCGG + Intronic
1160858283 19:1227086-1227108 GCTCAGAGCCTGCGGCACCCCGG - Intronic
1162481333 19:10928600-10928622 GCAGAGAGCCCCAGCCACGCCGG - Exonic
1163423105 19:17226210-17226232 GCTGAGCGACCCCGCCAGTCGGG + Exonic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
926541069 2:14182443-14182465 GCCCAGAGCCTCTGCCTCTCTGG + Intergenic
926675895 2:15619340-15619362 GCCCAGAGTCTCCACCACTCTGG - Intronic
928606403 2:32947765-32947787 GCCTAGAGCCTCCGCCGCTCTGG - Exonic
930089441 2:47521103-47521125 GCCGAGGGCCGCCGCCTCTCGGG - Exonic
932657264 2:73620875-73620897 GCAGAGAGCCTTGGCCACACAGG + Intergenic
932663941 2:73681123-73681145 GCAGAGAGCCTTGGCCACACAGG + Intergenic
934937558 2:98476513-98476535 GCTGAGAGCCTCCCTGACTGTGG - Intronic
935708459 2:105876879-105876901 GCTTAGAGCCTGGACCACTCAGG + Intronic
947546651 2:231015200-231015222 GCTGATAGTCCCAGCCACTCAGG - Intronic
1173247123 20:41344620-41344642 GATGAGAGCCTCCTCCAAGCTGG - Intronic
1174585762 20:51606862-51606884 AGTGAGACCCTCCGCCACCCAGG + Intronic
1179946411 21:44681203-44681225 CCTGAGATCCTCCGCGACCCGGG + Intronic
1181003871 22:20000332-20000354 GCTGGGAGCCAGCTCCACTCCGG + Intronic
1184554362 22:45225236-45225258 GCTGAGGGCCTCCCTCCCTCGGG + Intronic
1185150479 22:49161152-49161174 GCTCAGAGCCCCGGCCCCTCCGG + Intergenic
1185337661 22:50278013-50278035 GCTGAGACCCTCCCCCCCACAGG - Exonic
950853734 3:16086682-16086704 GCAGAAAGCCTCCAACACTCCGG - Intergenic
952870974 3:37901175-37901197 GCTGGGAGCATCAGGCACTCTGG - Intronic
957467341 3:80610699-80610721 GCAGAGAGCCACCAGCACTCGGG + Intergenic
958426881 3:93988992-93989014 GCTGAGAGCCTTCGCGAAGCTGG + Intronic
968894049 4:3388549-3388571 GCTGAGAGGCCCCTCCACCCTGG + Intronic
969054967 4:4396006-4396028 TCTGAGAGACTCCGCCACACGGG + Intronic
969870439 4:10101227-10101249 CCTGGGAGCCTCCGGCACTCTGG - Intronic
974260486 4:59518772-59518794 GCCCAGAGCCTCCGCTGCTCGGG - Intergenic
976301518 4:83520182-83520204 GGTGAGAGCCTTACCCACTCAGG + Intronic
980007402 4:127558644-127558666 GCCCAGAGCCTCCTTCACTCTGG + Intergenic
983872991 4:172843466-172843488 GCTGACAGCCTCCTGCACTGAGG + Intronic
984102325 4:175500120-175500142 GCCCAGAGCCTCTGCCACTCTGG - Intergenic
984738704 4:183138051-183138073 GCTGAGGGGCTCTGCCAGTCTGG + Intronic
985547969 5:519560-519582 CCAGGGAGCCTCCGCCACTGGGG - Intronic
999381401 5:151123937-151123959 GGTGAGCCTCTCCGCCACTCTGG - Intronic
1001752854 5:174144895-174144917 GCTGATAACCTTAGCCACTCAGG - Intronic
1002596438 5:180327086-180327108 GCTGAGATACTACGCCAGTCTGG + Intronic
1005114467 6:22319995-22320017 GCTGAGGGCCTCCTCCTGTCAGG + Intergenic
1006696677 6:35936803-35936825 GCTGAGTGCCAGGGCCACTCAGG - Intergenic
1007737800 6:43992748-43992770 GCAGAGAGCCTGAGCCAATCGGG - Intergenic
1011984033 6:93419618-93419640 GCTGAGAGCCTCCGCCACTCGGG + Intergenic
1014205255 6:118650636-118650658 GCTGAGAGCGGCCGCATCTCTGG + Intronic
1014227490 6:118864533-118864555 GCTGAGAGACTCCTACACACTGG + Intronic
1015102660 6:129499840-129499862 GCTGAAAGCCCCAGCTACTCGGG - Intronic
1019349905 7:549830-549852 GCTCAGAGACTCTCCCACTCCGG + Exonic
1020032778 7:4944481-4944503 ACGGAGAGCATCGGCCACTCCGG - Intronic
1021397882 7:20172840-20172862 GCTGAGAGCCTGTGCTGCTCTGG + Intronic
1023505885 7:40899253-40899275 GCAGAGAACCTCTGCCAGTCAGG - Intergenic
1025106436 7:56175076-56175098 GCTGAGTTCCTTCGCCACGCAGG - Intergenic
1025611696 7:63080444-63080466 GATGAGAGCCTCAGGAACTCAGG - Intergenic
1028921438 7:96314616-96314638 GCTGAGCGCTTCCTCCTCTCTGG - Intronic
1029588032 7:101487654-101487676 CCTGAGACCCTCGGCCACTCTGG + Intronic
1030889186 7:114977480-114977502 GTTGAGAGGCTCCACCACCCTGG + Intronic
1033186654 7:139232131-139232153 GGTGAGAGCCTCGGCCACCCTGG - Intronic
1034225642 7:149478518-149478540 GCTGAGAGCCATGGCAACTCAGG + Intronic
1037604114 8:20423024-20423046 GGTGAGACCCTCCGCCTCCCAGG + Intergenic
1038847784 8:31245719-31245741 CCTGAGAGCCTCTGCCTCTGTGG + Intergenic
1040983048 8:53265546-53265568 TCTGAGAGTCTCTGCCACACAGG - Intergenic
1043745391 8:83868835-83868857 GCCCAGAGCCTCTACCACTCTGG + Intergenic
1047194679 8:122710987-122711009 GCTGAGGGCCTCAGTCACTGTGG - Intergenic
1055533935 9:77216885-77216907 GCTCAGAGGCTAAGCCACTCTGG + Intronic
1056796364 9:89661556-89661578 TCTGTGAGCATCTGCCACTCTGG + Intergenic
1057546000 9:96021009-96021031 GCTGCGAGCCCCCGACACTGAGG - Intergenic
1057846719 9:98531581-98531603 GGTGAGAGCCACCGCCTGTCAGG - Intronic
1061003606 9:127916345-127916367 GCTGAGCTGCTCCGCCAGTCGGG + Intronic
1061544856 9:131298757-131298779 TCTGGGAGCCTCCAGCACTCTGG + Intronic
1188760497 X:34022773-34022795 GCTGATAGTCTCAGCTACTCGGG + Intergenic
1193573397 X:83172623-83172645 GCTGGGAGGCTACGCCAGTCTGG + Intergenic
1196765150 X:119236212-119236234 GCTTGGAGGCTCCGCCCCTCAGG + Intergenic
1197445725 X:126551435-126551457 GGAAAGAGCCTCCGCCACCCTGG - Exonic
1200375351 X:155774403-155774425 GCTGAGAGCCTCCTCGATTATGG + Exonic