ID: 1011986065

View in Genome Browser
Species Human (GRCh38)
Location 6:93447612-93447634
Sequence TCCGGGATGTCCATGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011986065_1011986070 -4 Left 1011986065 6:93447612-93447634 CCAAATGTCATGGACATCCCGGA No data
Right 1011986070 6:93447631-93447653 CGGAAGGTGAGGCTACAAACAGG No data
1011986065_1011986072 6 Left 1011986065 6:93447612-93447634 CCAAATGTCATGGACATCCCGGA No data
Right 1011986072 6:93447641-93447663 GGCTACAAACAGGGCTAGTACGG No data
1011986065_1011986071 -3 Left 1011986065 6:93447612-93447634 CCAAATGTCATGGACATCCCGGA No data
Right 1011986071 6:93447632-93447654 GGAAGGTGAGGCTACAAACAGGG No data
1011986065_1011986073 10 Left 1011986065 6:93447612-93447634 CCAAATGTCATGGACATCCCGGA No data
Right 1011986073 6:93447645-93447667 ACAAACAGGGCTAGTACGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011986065 Original CRISPR TCCGGGATGTCCATGACATT TGG (reversed) Intergenic
No off target data available for this crispr