ID: 1011987338

View in Genome Browser
Species Human (GRCh38)
Location 6:93465259-93465281
Sequence GGATGCCATGATGCTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011987333_1011987338 20 Left 1011987333 6:93465216-93465238 CCTTCTTGGAGTCATAACTGGAT No data
Right 1011987338 6:93465259-93465281 GGATGCCATGATGCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011987338 Original CRISPR GGATGCCATGATGCTTCTGT GGG Intergenic
No off target data available for this crispr