ID: 1011991593

View in Genome Browser
Species Human (GRCh38)
Location 6:93526522-93526544
Sequence ACAGTTCCCACCATATACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011991593_1011991597 23 Left 1011991593 6:93526522-93526544 CCCAAGTATATGGTGGGAACTGT No data
Right 1011991597 6:93526568-93526590 CACGATTTACATATAGCCCAAGG No data
1011991593_1011991595 -4 Left 1011991593 6:93526522-93526544 CCCAAGTATATGGTGGGAACTGT No data
Right 1011991595 6:93526541-93526563 CTGTTAAAGAAAGATTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011991593 Original CRISPR ACAGTTCCCACCATATACTT GGG (reversed) Intergenic
No off target data available for this crispr