ID: 1011991797

View in Genome Browser
Species Human (GRCh38)
Location 6:93529901-93529923
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011991797_1011991798 -7 Left 1011991797 6:93529901-93529923 CCAAGAAAACATAGATGAATGAA No data
Right 1011991798 6:93529917-93529939 GAATGAAGACATTAAGTATAAGG No data
1011991797_1011991799 1 Left 1011991797 6:93529901-93529923 CCAAGAAAACATAGATGAATGAA No data
Right 1011991799 6:93529925-93529947 ACATTAAGTATAAGGTAGAAAGG No data
1011991797_1011991800 14 Left 1011991797 6:93529901-93529923 CCAAGAAAACATAGATGAATGAA No data
Right 1011991800 6:93529938-93529960 GGTAGAAAGGAAATGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011991797 Original CRISPR TTCATTCATCTATGTTTTCT TGG (reversed) Intergenic
No off target data available for this crispr