ID: 1011995514

View in Genome Browser
Species Human (GRCh38)
Location 6:93582015-93582037
Sequence TCTTTTAAGTGGGCGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011995503_1011995514 27 Left 1011995503 6:93581965-93581987 CCTCTGCCTCCTGGGTTTGAGCA 0: 37
1: 559
2: 10929
3: 37497
4: 82176
Right 1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG No data
1011995507_1011995514 -10 Left 1011995507 6:93582002-93582024 CCTCCCTCTTTTTTCTTTTAAGT No data
Right 1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG No data
1011995506_1011995514 -4 Left 1011995506 6:93581996-93582018 CCTCAGCCTCCCTCTTTTTTCTT No data
Right 1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG No data
1011995504_1011995514 21 Left 1011995504 6:93581971-93581993 CCTCCTGGGTTTGAGCAATTCTC 0: 79
1: 1147
2: 23719
3: 70893
4: 146114
Right 1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG No data
1011995505_1011995514 18 Left 1011995505 6:93581974-93581996 CCTGGGTTTGAGCAATTCTCTGC No data
Right 1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011995514 Original CRISPR TCTTTTAAGTGGGCGGTGGC AGG Intergenic
No off target data available for this crispr