ID: 1011996750

View in Genome Browser
Species Human (GRCh38)
Location 6:93599332-93599354
Sequence AAATTTCCAGTGTTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011996746_1011996750 -7 Left 1011996746 6:93599316-93599338 CCCATATTTCATGTTGAAATTTC No data
Right 1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG No data
1011996745_1011996750 -4 Left 1011996745 6:93599313-93599335 CCACCCATATTTCATGTTGAAAT No data
Right 1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG No data
1011996747_1011996750 -8 Left 1011996747 6:93599317-93599339 CCATATTTCATGTTGAAATTTCC No data
Right 1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG No data
1011996744_1011996750 -3 Left 1011996744 6:93599312-93599334 CCCACCCATATTTCATGTTGAAA No data
Right 1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011996750 Original CRISPR AAATTTCCAGTGTTGGAGCA GGG Intergenic
No off target data available for this crispr