ID: 1011997474

View in Genome Browser
Species Human (GRCh38)
Location 6:93610739-93610761
Sequence GTAAAGACATAAAATTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011997474_1011997476 -1 Left 1011997474 6:93610739-93610761 CCCTTATAATTTTATGTCTTTAC No data
Right 1011997476 6:93610761-93610783 CTAATGAGATTCCTTTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011997474 Original CRISPR GTAAAGACATAAAATTATAA GGG (reversed) Intergenic
No off target data available for this crispr