ID: 1012001400

View in Genome Browser
Species Human (GRCh38)
Location 6:93659520-93659542
Sequence TCTAGGGTCTTTCCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012001400_1012001404 28 Left 1012001400 6:93659520-93659542 CCTCTTTGAGGAAAGACCCTAGA No data
Right 1012001404 6:93659571-93659593 TTTCTTCATGTTCTCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012001400 Original CRISPR TCTAGGGTCTTTCCTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr