ID: 1012001569

View in Genome Browser
Species Human (GRCh38)
Location 6:93661572-93661594
Sequence CAAAGCTTCTAAGAGTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012001566_1012001569 5 Left 1012001566 6:93661544-93661566 CCTGGCTCTAGAAGAACATACTT No data
Right 1012001569 6:93661572-93661594 CAAAGCTTCTAAGAGTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012001569 Original CRISPR CAAAGCTTCTAAGAGTGTCC GGG Intergenic
No off target data available for this crispr