ID: 1012001905

View in Genome Browser
Species Human (GRCh38)
Location 6:93664421-93664443
Sequence AGATATTTGCAGAAGATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012001905_1012001908 19 Left 1012001905 6:93664421-93664443 CCTACTATCTTCTGCAAATATCT No data
Right 1012001908 6:93664463-93664485 TTTAACCTGTTACTGGGCCTTGG No data
1012001905_1012001907 13 Left 1012001905 6:93664421-93664443 CCTACTATCTTCTGCAAATATCT No data
Right 1012001907 6:93664457-93664479 ACAGCTTTTAACCTGTTACTGGG No data
1012001905_1012001906 12 Left 1012001905 6:93664421-93664443 CCTACTATCTTCTGCAAATATCT No data
Right 1012001906 6:93664456-93664478 GACAGCTTTTAACCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012001905 Original CRISPR AGATATTTGCAGAAGATAGT AGG (reversed) Intergenic
No off target data available for this crispr